Transcript asmbl_71506

Sequence
Transcript Sequence for observation asmbl_71506 of TGE0057056:
CGCCGCCGCCGCCGCCGGAGCCTGCGCGTCCCGCGGTCCCCGGCGGGCAGCTCCACCCCAATCCCGGCGGCCACCCGGCAGCCGCCCCGTTCACCAAACAAGGCAGGCAAGTTGTGCGCTCCAAGGTGCCGCAGGAGACCCAGAGCGGCGGAGGCTCTAGGCTGCAGGTTCACCAGAAGCAGCAGCTGCAGGGGGTCAATGTCTGTGGAGGGCGGTGCTGTCATGGCTGGAGTAAGGCCCCTGGCTCCCAGAGGTGCACCAAACCTAGCTGTGTTCCGCCATGTCAGAATGGAGGGATGTGTCTCCGGCCACAACTCTGTGTGTGTAAACCAGGGACCAAGGGCAAAGCCTGTGAAACAATAGCTGCCCAGGACACCTCGTCACCAGTCTTTGGAGGGCAGAGTCCTGGGGCTGCTTCCTCGTGGGGCCCTCCTGAGCAAGCAGCAAAGCATACTTCATCTAAGAAGGCAGACACTCTACCAAGAGTCAGCCCTGTGGCCCAGATGACCTTAACCCTCAAGCCGAAGCCTTCAGTGGGACTCCCCCAGCAGATACATTCTCAAGTGACTCCTCTTTCTTCCCAGAGTGTGGTGATTCACCATGGCCAGACCCAGGAATACGTGCTCAAGCCCAAGTACTTTCCAGCCCAGAAGGGGATTTCAGGAGAGCAGTCCACTGAAGGTTCTTTCCCTTTAAGATATGTGCAGGATCAAGTTGCGGCACCTTTTCAGCTGAGTAACCACACTGGCCGCATCAAGGTGGTCTTTACTCCGAGCATCTGTAAAGTGACCTGCACCAAGGGCAGCTGTCAGAACAGCTGTGAGAAGGGGAACACCACCACTCTCATTAGTGAGAATGGTCATGCTGCCGACACCCTGACGGCCACGAACTTCCGAGTGGTAATTTGCCATCTTCCATGTATGAATGGTGGCCAGTGCAGTTCAAGGGACAAATGTCAGTGCCCTCCAAATTTCACAGGAAAACTTTGTCAGATCCCAGTCCATGGTGCCAGCGTGCCTAAACTTTATCAGCATTCCCAGCAGCCAGGCAAGGCGTTGGGGACGCATGTCATCCATTCAACACATACCTTGCCTCTGACCGTGACTAGCCAGCAAGGAGTCAAAGTGAAATTTCCTCCTAACATAGTCAATATCCATGTGAAACATCCTCCTGAAGCTTCCGTCCAGATACATCAGGTTTCAAGAATTGATGGCCCAACAGGCCAGAAGACAAAAGAAGCTCAACCAGGCCAATCCCAAGTCTCGTACCAAGGGCTTCCTGTCCAGAAGACCCAGACCATACATTCCACATACTCCCACCAGCAGGTCATTCCTCACGTCTACCCCGTGGCTGCTAAGACACAGCTTGGCCGGTGCTTCCAGGAAACCATTGGGTCACAGTGTGGCAAAGCGCTCCCTGGCCTTTCAAAGCAAGAGGACTGCTGTGGAACTGTGGGTACCTCCTGGGGCTTTAACAAATGCCAGAAATGCCCCAAGAAACCATCTTATCATGGATACAACCAAATGATGGAATGCCTACCGGGTTATAAGCGGGTTAACAACACCTTTTGCCAAGATATTAATGAATGTCAGCTACAAGGTGTATGCCCTAATGGTGAGTGTTTGAATACCATGGGCAGCTATCGATGTACCTGCAAAATAGGATTTGGGCCGGATCCTACCTTTTCAAGTTGTGTTCCTGATCCCCCTGTGATCTCGGAAGAGAAAGGGCCCTGTTACCGACTTGTCAGTTCTGGAAGACAGTGTATGCACCCTCTGTCTGTTCACCTCACCAAGCAGCTCTGCTGTTGTAGTGTGGGCAAGGCCTGGGGCCCACACTGTGAGAAATGTCCCCTTCCAGGCACAGCTGCTTTTAAGGAAATCTGTCCTGGTGGAATGGGTTATACGGTTTCTGGCGTTCATAGACGCAGGCCAATCCATCACCATGTAGGTAAAGGACCTGTATTTGTCAAGCCAAAGAACACTCAACCTGTTGCTAAAAGTACTCATCCTCCACCTCTCCCAGCCAAGGAAGAGCCAGTGGAGGCCCTGACCTTCTCCCGGGAACACGGGCCAGGAGTGGCGGAGCCAGAAGTGGCAACTGCACCCCCTGAAAAGGAAATACCTTCATTGGATCAAGAGAAAACCAAACTTGAGCCTGGTCAACCCCAGCTGTCTCCAGGCATTTCCACTATTCATCTGCATCCACAGTTTCCAGTAGTGATTGAAAAAACATCACCTCCTGTGCCTGTTGAAGTAGCTCCTGAAGCTTCTACGTCTAGTGCCAGCCAAGTGATTGCTCCTACTCAAGTGACAGAAATCAATGAATGTACTGTGAACCCTGATATCTGTGGAGCAGGACACTGCATTAACCTACCAGTGAGATATACCTGTATATGCTACGAGGGCTACAGGTTCAGTGAACAACAGAGGAAATGTGTGGATATTGATGAGTGTACTCAGGTCCAACACCTCTGCTCCCAGGGCCGCTGTGAAAACACCGAGGGAAGTTTCTTGTGCATTTGCCCAGCAGGATTTATGGCCAGTGAGGAGGGTACTAACTGCATAGATGTTGACGAATGCCTGAGGCCGGACGTCTGTGGGGAGGGGCACTGTGTCAATACTGTGGGGGCCTTCCGGTGTGAATACTGTGACAGCGGGTACCGCATGACTCAGAGAGGCCGTTGTGAGGATATTGATGAATGTTTGAATCCAAGCACTTGTCCAGATGAGCAGTGTGTGAATTCTCCTGGATCTTACCAGTGCGTTCCCTGCACAGAAGGATTCCGAGGCTGGAATGGACAGTGCCTTGATGTGGACGAGTGCCTGGAACCAAACGTCTGCGCAAATGGTGATTGTTCCAACCTTGAAGGCTCCTACATGTGTTCATGCCACAAAGGCTATACCCGGACTCCGGACCACAAGCACTGTAGAGATATTGATGAATGTCAGCAAGGGAATCTATGTGTAAACGGGCAGTGCAAAAATACCGAGGGCTCCTTCAGGTGCACCTGTGGACAGGGGTACCAGCTGTCGGCAGCTAAAGACCAGTGTGAAGACATTGATGAATGCCAGCACCGTCATCTCTGTGCTCATGGGCAGTGCAGGAACACTGAGGGCTCTTTTCAATGTGTGTGTGACCAGGGTTACAGAGCATCTGGGCTTGGAGACCACTGTGAAGATATCAATGAATGCTTGGAGGACAAGAGTGTTTGCCAGAGAGGAGACTGCATTAATACTGCAGGGTCCTATGATTGTACTTGTCCGGATGGATTTCAGCTAGATGACAATAAAACATGTCAAGATATTAATGAATGTGAACATCCAGGGCTCTGTGGTCCGCAAGGGGAGTGCCTAAACACAGAGGGTTCTTTCCATTGTGTCTGCCAGCAGGGTTTCTCAATCTCTGCAGATGGCCGTACGTGTGAAGATATTGATGAATGTGTAAACAACACTGTTTGTGACAGTCACGGGTTTTGTGACAATACAGCTGGCTCCTTCCGCTGCCTCTGTTATCAGGGCTTTCAAGCCCCACAGGATGGGCAAGGGTGTGTGGATGTGAATGAATGTGAACTGCTCAGTGGGGTGTGTGGTGAAGCCTTCTGTGAAAACGTGGAAGGGTCCTTCCTGTGCGTGTGTGCTGATGAAAACCAAGAGTACAGCCCCATGACTGGGCAGTGCCGCTCCCGGACCTCCACAGATTTAGATGTAGATGTAGATCAACCCAAAGAAGAAAAGAAAGAATGCTACTATAATCTCAATGACGCCAGTCTCTGTGATAATGTGTTGGCCCCCAATGTCACGAAACAAGAATGCTGCTGTACATCAGGCGTGGGATGGGGAGATAACTGCGAAATCTTCCCCTGCCCGGTCTTGGGAACTGCTGAGTTCACTGAAATGTGTCCCAAAGGGAAAGGTTTTGTGCCTGCTGGAGAATCATCTTCTGAAGCTGGTGGTGAGAACTATAAAGATGCAGATGAATGCCTACTTTTTGGACAAGAAATCTGCAAAAATGGTTTCTGTTTGAACACTCGGCCTGGGTATGAATGCTACTGTAAGCAAGGGACGTACTATGATCCTGTGAAACTGCAGTGCTTTGATATGGATGAATGTCAAGACCCCAGTAGTTGTATTGATGGCCAGTGTGTTAATACAGAGGGCTCTTACAACTGCTTCTGTACTCACCCCATGGTCCTGGATGCGTCAGAAAAAAGATGTATACGACCGGCTGAGTCAAACGAACAAATAGAAGAAACTGATGTCTACCAAGATTTGTGCTGGGAACATCTGAGTGATGAATACGTGTGTAGCCGGCCTCTTGTGGGCAAGCAGACAACGTACACTGAGTGCTGCTGTCTGTATGGAGAGGCCTGGGGCATGCAGTGTGCCCTCTGCCCCCTGAAGGATTCAGATGACTATGCTCAGCTGTGTAACATCCCCGTGACGGGACGCCGGCAGCCATATGGACGGGACGCCTTGGTTGACTTCAGTGAACAGTATACTCCAGAAGCCGATCCCTACTTCATCCAAGACCGTTTTCTAAATAGCTTTGAGGAGTTACAGGCTGAGGAATGCGGCATCCTCAATGGATGTGAAAATGGTCGCTGTGTGAGGGTCCAGGAAGGTTACACCTGCGATTGCTTTGATGGGTATCACTTGGATACGGCCAAGATGACCTGTGTCGATGTAAATGAATGCGATGAGTTGAACAACCGGATGTCTCTCTGCAAGAATGCCAAGTGCATTAACACCGATGGTTCCTACAAGTGTTTGTGTCTGCCAGGCTACGTGCCTTCTGACAAGCCAAACTACTGCACTCCGTTGAATACCGCCTTGAATTTAGAGAAAGACAGTGACCTGGAGTGAAACAGAATCTACATAACCTAAGCCCATATACTCTGCACTGTGTAAAGGAAAAGGGAGAAATGTATTATACTTGAGACATTGCACCTACCCCGGAAGGCTGGAAATACAGAAACAGCATGGAATTGCAAGTCCTCTGAAGACAATGAGAGGATTTAGGATGAGCCCGATAGGTGTGGCAGACCAAATGGACATTTCTCTAAAAAACCAGTATATATAGTCTGTTCATATGTAAAATTCAATGGAAGAGAGGTGGAACAGTGCTGTTATTTTAAACAGAAGGTTGTATTATTATGTTGTTTTGTTTTTTTACTATTGCTTGATTAAATTTGGCATTTAAATAGTGGTGGAAATATTTTATATAATTTTCATTTTTTGGTTGTGCAGTTCCTTGGCTACTGTTTTTCTTTTACTTCAGTTTTTTAAAAATCTCAAATGAAAAAGTCTTCGATACAATATTGTTAAGCTGTATTATAAGTATTGTTACACAGGGTTATGCAATTCCCGGCCTGGAGCATTTTTGAAATTCAAATTGTCTGTCCTGTGGAGCAGGCAGTGATTTTGTTCCAAAACTTTGTATACACATTTGGAGAAAAGTACTTTATATTTTCAGTGTTTTGTCTGATTTTAATGTCCGTTCTTAGCCAAGCTGCTAGCAGGTGTTAATTGGATCCCTTTCCTTCACTGAAATGGAAGAGTTTATAAGCTTACGTTAGTATTGTAATATGTAAAGTAAGCCCAACAAAAATTTTTAAAAATTTGATGATCCCCAATATATCTACCATTGTATGTTAAATAAATCACCATTTTTGTAGAAAAAATTCTACCTGAGAGTAATTGTCAATGAGTACATGTGTATAAGTTGTATCCCACTCTCCCCACTTTTATCTTTTCCAGTGGTCTTCTGTTAATGTAGTGTCTT