Transcript asmbl_71434

Sequence
Transcript Sequence for observation asmbl_71434 of TGE0056598:
AGCCACTCTCGCGCCTCCGAACAGCCACAGGGGCAAAGCCCTGTCACCCCCAGGATCCGGTCATCAGGGAAAGAGGACAGGGAGACCAGAAGAGGGCCAGCTGGGACGAGGGGGCGGACGCCCAGGAGGCAACTTCTGAGACGCAGCTCCTGAGAGGGGCAGGGACCAGGCGCGGGAGGCCAGAGGGGGCACAGAGAACAAACCCCCTCAGAAGTGAAGAGGAGAGCGGAAGGAACCGAGAGGGGACGGACAGGAGCTGAGGAGGAAAGAGGAGGGGAGAGGGGTCAGGCCAGGCAGCCAAGGAGAAGACGTGTGGCCGGGGGCTATCAGAAGGAAACTGGGACGGACGGGCCGGGCTCGGGCTGTCCTGTGGAGCAGCAGCATCCCCGGGGCCGGCAGAGGCGCCAGTGGCTGGGCGGGATGAGTCTCTGAGGGCCACTGTGGAGCGCCCCGCCATGGCCCCCCGCACCCTCTGGAGCTGCTACCTCTGCTGCCTGCTGACGGCAGCTGCAGGGGCCGCCAGCTACCCTCCTCGAGGTTTCAGCCTCTACACAGGTTCCAGTGGGGCCCTCAGCCCCGGGGGGCCCCAGGCCCAGATTGCCCCCCGGCCAGCCAGCCGCCACAGGAACTGGTGTGCCTACGTGGTGACCCGGACAGTGAGCTGTGTCCTTGAGGATGGAGTGGAGACATATGTCAAGTACCAGCCTTGTGCCTGGGGCCAGCCCCAGTGTCCCCAAAGCATCATGTACCGCCGCTTCCTCCGCCCTCGCTACCGTGTGGCCTACAAGACAGTGACCGACATGGAGTGGAGGTGCTGTCAGGGTTATGGGGGCGATGACTGTGCTGAGAGTCCCGCTCCAGCGCTGGGGCCTGCGTCTTCCACACCACGGCCCCTGGCCCGGCCTGCCCGCCCCAACCTCTCTGGCTCCAGTGCAGGCAGCCCCCTCAGTGGACTGGGGGGAGAAGGTCCTGGGGAGTCAGAGAAGGTGCAGCAGCTGGAGGAACAGGTGCAGAGCCTGACCAAGGAGCTGCAAGGCCTGCGGGGCGTCCTGCAAGGACTGAGCGGGCGCCTGGCAGAGGATGTGCAGAGGGCTGTGGAGACGGCCTTCAACGGGAGGCAGCAGCCAGCTGACGCGGCTGCCCGCCCTGGGGTGCATGAAACCCTCAATGAGATCCAGCACCAGCTGCAGCTCCTGGACACCCGCGTCTCCACCCACGACCAGGAGCTGGGTCACCTCAACAACCATCATGGCGGCAGCAGCAGCAGTGGGGGCAGCAGGGCCCCAGCCCCAGCCTCAGCCCCTCCGGGCCCCAGTGAGGAGCTGCTGCGGCAGCTGGAGCAGCGGTTGCAGGAGTCCTGCTCCGTGTGCCTGGCCGGGCTAGATGGCTTCCGCCGGCAGCAGCAGGAGGACAGGGAGCGGCTGCGAGCGATGGAGAAGCTGCTGGCCTCGGTGGAGGAGCGGCAACGGCACCTCGCAGGGCTGGCGGTGGGCCGCAGGCCCCCTCAGGAATGCTGCTCTCCAGAGCTGGGCCGGCGACTGGCAGAGCTGGAGCGCAGGCTGGATGTCGTGGCCGGCTCAGTGACAGTGCTGAGTGGGCGGCGAGGCACAGAGCTGGGAGGAGCCGCGGGGCAGGGAGGCCACCCCCCAGGCTACACCAGCTTGGCCTCCCGCCTGTCTCGCCTGGAGGACCGCTTCAACTCCACCCTGGGCCCTTCGGAGGAGCAGGAGGAGAGCTGGCCTGGGGCTCCTGGGGGGCTGAGCCACTGGCTGCCTGCTGCCCGGGGCCGACTAGAGCAGTTGGGGGGGCTGCTGGCCAATGTGAGCGGGGAGCTGGGGGGGCGGTTGGATCTGTTGGAGGAGCAGGTGGCAGGGGCCATGCAGGCATGCGGGCAGCTCTGCTCTGGGGCCCCTGGGGAGCAGGACTCTCAAGTCAGCGAGATCCTCAGTGCCTTGGAGCGCAGGGTGCTGGACAGTGAGGGGCAGCTGCGGCTGGTGGGCTCCGGCCTGCACACGGTGGAAGCAGCGGGGGAGGCCCGGCAGGCCACGCTGGAGGGATTACAAGAGGTTGTGGGCCGGCTCCAGGATCGTGTGGATGCCCAGGATGAGACAGCTGCAGAGTTCACACTACGGCTGAATCTCACTGCGGCCCGGCTAGGCCAACTGGAGGGGCTGCTGCAGGCCCATGGGGATGAGGGCTGTGGGGCCTGTGGCGGAGTCCAAGAGGAACTAGGCCGCCTTCGGGATGGTGTGGAGCGCTGCTCCTGCCCCCTGTTGCCTCCTCGGGGTCCTGGGGCTGGTCCAGGTGTTGGGGGCCCAAGCCGTGGGCCCCTGGACGGCTTCAGCGTGTTTGGGGGCAGCTCAGGCTCAGCCCTGCAGGCCCTGCAAGGAGAGCTCTCTGAGGTTATTCTCAGCTTCAGCTCCCTCAATGACTCACTGAATGAGCTCCAGACCACTGTGGAGGGCCAGGGCGCTGATCTGGCTGACCTGGGGGCAACCAAGGACCGTATCATTTCTGAGATTAACAGGCTGCAGCAGGAGGCCACAGAGCATGCTACAGAGAGTGAAGAGCGCTTCCGAGGCCTAGAGGAGGGACAAGCACAGGCCGGCCAGTGCCCCAGCTTAGAGGGGCGATTGGGCCGTCTTGAGGGTGTCTGTGAACGGTTGGACACTGTGGCTGGGGGACTGCAGGGCCTGCGCGAGGGCCTTTCCAGACACGTGGCTGGGCTCTGGGCTGGGCTCCGGGAAACCAACACCACCAGCCAGATGCAGGCAGCCCTGCTGGAGAAGCTGGTCGGGGGACAGGCGGGCCTGGGCAGGCGGCTGGGTGCCCTTAACAGCTCCCTGCAGCTCCTGGAGGACCGTCTGCACCAGCTCAGCCTGAAGGACCTCACTGGGCCTGCAGGAGAGGCTGGGCCCCCAGGGCCTCCTGGGCTGCAGGGACCCCCAGGCCCTGCTGGACCTCCAGGATCACCAGGCAAGGACGGGCAAGAGGGCCCCATCGGGCCACCAGGTCCTCAAGGTGAACAGGGAGTGGAGGGGGCACCAGCAGCCCCTGTGCCCCAAGTGGCATTTTCAGCTGCTCTGAGTTTGCCCCGGTCTGAACCAGGCACGGTCCCCTTCGACAGAGTCCTGCTCAATGATGGAGGCTATTATGATCCAGAGACAGGCGTGTTCACAGCGCCACTGGCTGGACGCTACTTGCTGAGCGCGGTGCTGACTGGGCACCGGCACGAGAAAGTGGAGGCCGTGCTGTCCCGCTCCAACCAGGGCGTGGCCCGCGTAGACTCCGGTGGCTACGAGCCTGAGGGCCTGGAGAATAAGCCGGTGGCCGAGAGCCAGCCCAGCCCGGGCACCCTGGGCGTCTTCAGCCTCATCCTGCCGCTGCAGGCCGGGGACACGGTCTGCGTCGACCTGGTCATGGGGCAGCTGGCGCACTCGGAGGAGCCGCTCACCATCTTCAGCGGGGCCCTGCTCTATGGGGACCCAGAGCTTGAACACGCGTAGACTGGGGTCCCGCCCGACGTGTCTACGTCGGCTGAAGAGACAGCGGGGGCGGCGGGCTCCTGGGGTCTCGCCTGAGACGGGGCACCTAGCCCTGGGCGAGCGCCGCACCCGGGCCCGCAGCGGCACCGCGCCCAGAGCGGCCTCTCCCCACGCCCGGGGCGCGCCGGCTCAGGGAGGCTCGGGGCCGCCCATGCAGACTTTTGGCCTGGCGCGATCCCCCAAGAACCCCTCCAGGGCCGGCCTGCGGAGGAGCCGATCCTCGCACCCTCCGCTCCCTCCACTGGCCCTCCAGGTCGATTCCCTGGGCTCCAGGCTCCCCCGCGCGGGCGCCGCCCACCGCCATACTAAACGATCGAGGAATAAAGACA