Transcript asmbl_65680

Sequence
Transcript Sequence for observation asmbl_65680 of TGE0001148:
GCTGAAGCAGCTGAAGCGGCGGTAGCGGCGGCGGCTCGGGCAGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGCGGAATGGTGGACTACCACGCGGCGAACCAGTCGTACCAGTACGGCCCCAGCAGCGCGGGCAATGGCGCTGGCGGCGGGGGCAGCATGGGCGACTACATGGCCCAGGAGGACGACTGGGACCGGGACCTGCTGCTGGACCCGGCCTGGGAGAAGCAGCAGCGCAAGACCTTCACGGCATGGTGCAACTCCCACCTGCGGAAGGCAGGCACACAGATCGAGAACATTGATGAGGACTTCCGAGACGGGCTCAAGCTCATGCTGCTCCTGGAGGTCATATCAGGGGAGCGGTTACCTAAGCCGGAGCGGGGGAAGATGAGAGTGCACAAAATCAACAATGTGAACAAAGCGCTGGACTTTATTGCCAGCAAAGGCGTCAAGCTGGTCTCCATCGGGGCAGAAGAGATTGTGGACGGCAACGCAAAGATGACCCTGGGAATGATCTGGACCATCATCCTTAGGTTCGCCATCCAGGACATCTCCGTGGAAGAGACCTCGGCCAAGGAAGGGCTCCTTCTCTGGTGCCAGAGAAAGACAGCCCCGTATAAGAACGTCAATGTGCAGAACTTCCACATCAGCTGGAAGGATGGTCTTGCCTTCAATGCCCTGATCCACCGGCACAGACCAGAGCTGATTGAGTATGACAAGCTGAGGAAGGACGACCCTGTCACCAACCTGAACAATGCCTTCGAAGTGGCTGAGAAATACCTCGACATCCCCAAGATGCTGGATGCAGAGGACATCGTGAACACGGCCCGGCCCGACGAGAAGGCCATAATGACCTATGTGTCCAGCTTCTACCATGCCTTTTCAGGAGCGCAGAAGGCTGAAACTGCCGCCAACCGGATCTGTAAGGTGCTGGCTGTCAACCAAGAGAACGAGCACCTGATGGAGGACTACGAGAAGCTGGCCAGCGACCTCCTGGAGTGGATCCGGCGCACCATCCCCTGGCTGGAGGACCGTGTGCCCCAAAAGACTATCCAGGAGATGCAGCAGAAGCTGGAGGACTTCCGCGACTACCGGCGTGTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGCCTCAGCAACCGGCCCGCCTTCATGCCCTCCGAGGGCAAGATGGTCTCGGACATCAACAATGGCTGGCAGCACTTGGAGCAGGCTGAGAAGGGCTACGAGGAGTGGCTGCTGAATGAGATCCGCAGGCTGGAGCGGCTCGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACTGACGGGAAGGAAGCCATGCTGAAGCACCGGGACTACGAGACGGCCACACTATCGGACATCAAAGCCCTCATTCGCAAGCACGAGGCCTTCGAGAGCGACCTGGCTGCGCACCAGGACCGCGTGGAGCAGATCGCCGCCATTGCCCAGGAGCTCAACGAGCTGGATTACTACGACTCCCACAATGTCAACACCCGGTGCCAGAAGATCTGTGACCAGTGGGACGCCCTCGGCTCTCTGACACATAGTCGCAGGGAAGCCCTGGAGAAAACAGAGAAGCAGCTGGAGGCCATCGACCAGCTGCACCTGGAATACGCCAAGCGCGCGGCCCCCTTCAACAACTGGATGGAGAGCGCCATGGAGGACCTCCAGGACATGTTCATCGTCCATACCATCGAGGAGATTGAGGGCCTGATCTCAGCCCATGACCAGTTCAAGTCCACCCTGCCGGACGCCGATAGGGAGCGCGAGGCCATCCTGGCCATCCACAAGGAGGCCCAGAGGATCGCTGAGAGCAACCACATCAAGCTGTCGGGCAGCAACCCCTACACCACCGTCACCCCGCAAATCATCAACTCCAAGTGGGAGAAGGTGCAGCAGCTGGTGCCAAAACGGGACCATGCCCTCCTGGAGGAGCAGAGCAAGCAGCAGTCCAACGAGCACCTGCGCCGCCAGTTCGCCAGCCAGGCCAATGTTGTGGGGCCCTGGATCCAGACCAAGATGGAGGAGATCGGGCGCATCTCCATTGAGATGAACGGGACCCTGGAGGACCAGCTGAGCCACCTGAAGCAGTATGAACGCAGCATCGTGGACTACAAGCCCAACCTGGACCTGCTGGAGCAGCAGCACCAGCTCATCCAGGAGGCCCTCATCTTCGACAACAAGCACACCAACTATACCATGGAGCACATCCGCGTGGGCTGGGAGCAGCTGCTCACCACCATTGCCCGCACCATCAACGAGGTGGAGAACCAGATCCTCACCCGCGACGCCAAGGGCATCAGCCAGGAGCAGATGCAGGAGTTCCGGGCGTCCTTCAACCACTTCGACAAGGATCATGGCGGGGCGCTGGGGCCCGAGGAGTTCAAGGCCTGCCTCATCAGCCTGGGCTACGACGTGGAGAACGACCGGCAGGGTGAGGCCGAGTTCAACCGCATCATGAGCCTGGTCGACCCCAACCATAGCGGCCTTGTGACCTTCCAAGCCTTCATCGACTTCATGTCGCGGGAGACCACCGACACGGACACGGCTGACCAGGTCATCGCTTCCTTCAAGGTCTTAGCAGGGGACAAGAACTTCATCACAGCTGAGGAGCTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCGCCATACCAGGGCCCTGACGCCGTGCCCGGTGCCCTCGACTACAAGTCCTTCTCCACGGCCTTGTATGGCGAGAGCGACCTGTGAGGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCTGTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGGG