Transcript asmbl_65679

Sequence
Transcript Sequence for observation asmbl_65679 of TGE0057052:
GCTGAAGCAGCTGAAGCGGCGGTAGCGGCGGCGGCTCGGGCAGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGCGGAATGGTGGACTACCACGCGGCGAACCAGTCGTACCAGTACGGCCCCAGCAGCGCGGGCAATGGCGCTGGCGGCGGGGGCAGCATGGGCGACTACATGGCCCAGGAGGACGACTGGGACCGGGACCTGCTGCTGGACCCGGCCTGGGAGAAGCAGCAGCGCAAGACCTTCACGGCATGGTGCAACTCCCACCTGCGGAAGGCAGGCACACAGATCGAGAACATTGATGAGGACTTCCGAGACGGGCTCAAGCTCATGCTGCTCCTGGAGGTCATATCAGGGGAGCGGTTACCTAAGCCGGAGCGGGGGAAGATGAGAGTGCACAAAATCAACAATGTGAACAAAGCGCTGGACTTTATTGCCAGCAAAGGCGTCAAGCTGGTCTCCATCGGGGCAGAAGAGATTGTGGACGGCAACGCAAAGATGACCCTGGGAATGATCTGGACCATCATCCTTAGGTTCGCCATCCAGGACATCTCCGTGGAAGAGACCTCGGCCAAGGAAGGGCTCCTTCTCTGGTGCCAGAGAAAGACAGCCCCGTATAAGAACGTCAATGTGCAGAACTTCCACATCAGCTGGAAGGATGGTCTTGCCTTCAATGCCCTGATCCACCGGCACAGACCAGAGCTGATTGAGTATGACAAGCTGAGGAAGGACGACCCTGTCACCAACCTGAACAATGCCTTCGAAGTGGCTGAGAAATACCTCGACATCCCCAAGATGCTGGATGCAGAGGACATCGTGAACACGGCCCGGCCCGACGAGAAGGCCATAATGACCTATGTGTCCAGCTTCTACCATGCCTTTTCAGGAGCGCAGAAGGCTGAAACTGCCGCCAACCGGATCTGTAAGGTGCTGGCTGTCAACCAAGAGAACGAGCACCTGATGGAGGACTACGAGAAGCTGGCCAGCGACCTCCTGGAGTGGATCCGGCGCACCATCCCCTGGCTGGAGGACCGTGTGCCCCAAAAGACTATCCAGGAGATGCAGCAGAAGCTGGAGGACTTCCGCGACTACCGGCGTGTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGCCTCAGCAACCGGCCCGCCTTCATGCCCTCCGAGGGCAAGATGGTCTCGGACATCAACAATGGCTGGCAGCACTTGGAGCAGGCTGAGAAGGGCTACGAGGAGTGGCTGCTGAATGAGATCCGCAGGCTGGAGCGGCTCGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACTGACGGGAAGGAAGCCATGCTGAAGCACCGGGACTACGAGACGGCCACACTATCGGACATCAAAGCCCTCATTCGCAAGCACGAGGCCTTCGAGAGCGACCTGGCTGCGCACCAGGACCGCGTGGAGCAGATCGCCGCCATTGCCCAGGAGCTCAACGAGCTGGATTACTACGACTCCCACAATGTCAACACCCGGTGCCAGAAGATCTGTGACCAGTGGGACGCCCTCGGCTCTCTGACACATAGTCGCAGGGAAGCCCTGGAGAAAACAGAGAAGCAGCTGGAGGCCATCGACCAGCTGCACCTGGAATACGCCAAGCGCGCGGCCCCCTTCAACAACTGGATGGAGAGCGCCATGGAGGACCTCCAGGACATGTTCATCGTCCATACCATCGAGGAGATTGAGGGCCTGATCTCAGCCCATGACCAGTTCAAGTCCACCCTGCCGGACGCCGATAGGGAGCGCGAGGCCATCCTGGCCATCCACAAGGAGGCCCAGAGGATCGCTGAGAGCAACCACATCAAGCTGTCGGGCAGCAACCCCTACACCACCGTCACCCCGCAAATCATCAACTCCAAGTGGGAGAAGGTGCAGCAGCTGGTGCCAAAACGGGACCATGCCCTCCTGGAGGAGCAGAGCAAGCAGCAGTCCAACGAGCACCTGCGCCGCCAGTTCGCCAGCCAGGCCAATGTTGTGGGGCCCTGGATCCAGACCAAGATGGAGGAGATCGGGCGCATCTCCATTGAGATGAACGGGACCCTGGAGGACCAGCTGAGCCACCTGAAGCAGTATGAACGCAGCATCGTGGACTACAAGCCCAACCTGGACCTGCTGGAGCAGCAGCACCAGCTCATCCAGGAGGCCCTCATCTTCGACAACAAGCACACCAACTATACCATGGAGCACATCCGCGTGGGCTGGGAGCAGCTGCTCACCACCATTGCCCGCACCATCAACGAGGTGGAGAACCAGATCCTCACCCGCGACGCCAAGGGCATCAGCCAGGAGCAGATGCAGGAGTTCCGGGCGTCCTTCAACCACTTCGACAAGGTGAGCAGCCTGCCACCTCCTCGGCCTCTCCCCTCCCGCCGTTGCCGTACCAGCCCACACCTTCGTCTCTGCATCTGTTCGTCCATTCCCATCACAGTTGCTGAGCGTCGGCCGCCACTCCCAGGGCCAGCAGGGCCCTGCCACTGTCAGGGTGTAGGTGTGCGGCACCAAGACCCCAGCCTGGGCCACTTCACACGCACAGGCAGGGGGCCGGAGGTCCCAAGTCCTGCCTTCTGGGGTGGCATCCTCACCACCCCCAGGGCAGATGAAGTCTCAGCACACCCAGGCTTTGCGACCCGGTCTGTGAACCTGGACACAGACACCCCGCACAGTGCTTTTAGAATTCAGATTTGGTCCGGCAGCCTCATCAGAGGGGCCCTGAGCGCCAGAGTTTGCTGCCATCCCCAGCCCACCCCTGCCGGGC