Transcript asmbl_63220

Sequence
Transcript Sequence for observation asmbl_63220 of TGE0057050:
CGGCCATTTTGTCCCAGTCAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCGTGGTCCGCGCCCTTCCTCGGCGGGCCGGACTGGTCTCCAGAAATGCTTTGGGTTCATCTTTCATTGCTGCAAGGAACTTCCATGCCTCTAACACTCATCTTCAAAAGACTGGGACTGCTGAGATGTCCTCTATTCTTGAAGAGCGTATTCTTGGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGTGTCTTAAGTATTGGTGATGGTATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTAGAGTTTTCTTCAGGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTTGGAAATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGTTCCAGTTGGTGAGGAGCTGTTGGGTCGTGTAGTTGATGCCCTTGGTAATGCTATTGATGGAAAGGGTCCAATTGGTTCCAAGACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATTCCTCGAATTTCAGTGCGGGAACCAATGCAGACTGGCATTAAGGCTGTGGATAGCTTGGTGCCAATTGGTCGTGGTCAGCGTGAACTGATTATTGGTGACCGACAGACTGGGAAAACCTCAATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGATGGATCTGATGAAAAGAAGAAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCCCAGTTGGTGAAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCGGATGCTGCCCCACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTTAGAGACAATGGCAAACATGCTTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCTTACCGTCAGATGTCTCTGTTGCTCCGCCGACCCCCTGGTCGTGAGGCCTATCCTGGTGATGTGTTCTACCTACACTCCCGGTTGCTGGAGAGAGCAGCCAAAATGAACGATGCTTTTGGTGGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACACAGGCTGGTGATGTGTCTGCTTACATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTGGAAACAGAATTGTTCTACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGATCCGCTGCCCAAACCAGGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTATCGTGAGGTTGCTGCTTTTGCCCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTTTTGAGTCGTGGCGTGCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCTATTGAAGAACAAGTGGCTGTTATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAGCCCAGCAAGATTACAAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAGCCAGCACCAAGCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTGAAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTAAACTCCTGTGGATTCACATCAAATACCAGTTCAGTTTTGTCATTGTTCTAGTAAATTAGTTCCATTTGTAAAAGGGTTACTCTCATACTCCTTATGTACAGAAATCACATGAAAAATAAAGGTTCCATAATGCATA