Transcript asmbl_62781

Sequence
Transcript Sequence for observation asmbl_62781 of TGE0057049:
GAGATCGTGCACATCCAGGCGGGCCAGTGCGGGAACCAGATCGGCACCAAGGTGGGCCTGGCGCGGTGCAGGGCCTCTCCGCGGGTCGGCTGCTGGCGGGCCCCGGGTCTCCCGGCGCGACCCCCGCCGGGGCGCGCACCCGCTGTGCGCCCCTGGGTCCTCGGAGCCCGGTGCGGACCCGCGAGGGCCGCAGGGAGGGAGCGCCCGGGGCGTGGCCGGCCGGGGACCTTCTACTCTTCGCTCCCCACCCCCATCCCAACTGGGAGCGGCTGCCGGCGGCTCAGGCGCGCCTGGAATTCGGCCGCCGGGGCGCCTGGGGTGGGCGCGGGTGGCGGCGTCCCGGGCTCTGGGTTCTGAGCGTCTGTCCCCCCGCCTTGCCCTGCCCAAGTTTTGGGAAGTGATCAGCGATGAGCACGGCATCGACCCGGCCGGAGGCTACGTGGGAGACTCGGCGCTGCAGCTGGAGAGAATCAACGTCTACTACAATGAGTCATCGTCTCAGAAATATGTGCCCAGGGCCGCCCTGGTGGACTTAGAGCCAGGCACCATGGACAGCGTGCGGTCTGGGCCTTTTGGGCAGCTTTTCCGGCCTGACAACTTCATCTTTGGCCAGACGGGTGCAGGGAACAACTGGGCGAAAGGGCACTACACGGAGGGCGCGGAGCTGGTGGACGCAGTGCTGGACGTGGTGCGGAAGGAGTGCGAGCACTGCGACTGCCTGCAGGGCTTCCAGCTCACGCACTCGCTGGGCGGCGGCACGGGCTCAGGCATGGGCACGCTGCTCATCAGCAAGATCCGTGAGGAGTTCCCGGACCGCATCATGAACACCTTCAGCGTCATGCCCTCGCCCAAGGTGTCGGACACGGTGGTGGAGCCCTACAATGCCACACTGTCGGTGCACCAGCTGGTGGAGAATACAGACGAGACCTACTGCATCGACAACGAGGCGCTCTATGACATCTGCTTCCGCACTCTGAAGCTGACAACGCCCACCTACGGGGACCTCAACCACCTGGTGTCCGCCACCATGAGTGGGGTCACCACCTCGCTGCGCTTCCCGGGCCAGCTCAATGCTGACCTGCGCAAGCTGGCGGTGAACATGGTGCCCTTCCCGCGCCTGCACTTCTTCATGCCTGGCTTCGCGCCGCTCACCAGCCGCGGCAGCCAGCAGTACCGGGCCCTGACCGTGCCCGAGCTCACCCAGCAGATGTTCGACGCCAGGAACATGATGGCCGCCTGCGATCCGCGCCATGGCCGCTACCTGACCGTGGCCACCGTGTTCCGCGGGCCCATGTCCATGAAGGAGGTGGACGAGCAGATGCTGGCCATCCAGAGTAAGAACAGCAGCTACTTCGTGGAGTGGATTCCCAACAACGTGAAGGTGGCCGTGTGCGACATCCCGCCCCGCGGCCTGAAGATGGCCTCCACCTTCATCGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCTCAGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTTCACGGGTGAGGGCATGGATGAAATGGAGTTCACCGAGGCGGAGAGCAACATGAACGACCTGGTATCCGAGTACCAGCAGTACCAGGATGCCACCGCCAATGACGGGGAGGAAGCTTTTGAGGATGAGGAAGAGGAGATCGATGGATAGTCGGAATAGAGCCGCCCCAACTCAGATCCTACAACACGCAAGTTCCTTCTTGAACCCTGGTGCCTCCTACCCTATGGCCCTGAATGGTGCACTGGTTTAATTGTGTTGGTGTCGGCCCCTCACAAATGCAGCCAAGTCATGTAATTAGTCATCTGGAACAAAGACTAAAAACAGCAGAGAATTGCGGGTTCTACCCAGTCAGAAGATCACACCATGGAGACTTTCTACTAGAGGACTTGAAAGAGAACTGAGGGGCCACAAAATAAACTTCACCTTCCATTAAGTGTTCAAGCATGTCTGCAAATTAGGAGGGAGTTAGAAACAGTCTTTTTCATCCTTTGTGATGAAGCCTGAAATTGTGCCGTGTTGCCTTATATGAATATGCAGTATGGGACTTTGAAATAATGATTCATAATAAAATACTAAACGTGTGTCTTCATCTCTCTAG