Transcript asmbl_62724

Sequence
Transcript Sequence for observation asmbl_62724 of TGE0000954:
AAAAGAAGGAAACTCAGTAACAGGACCCAGAGGACCATTATATATTGCTCTATATTCTAGGTCGCCCACTTTACACTTCCTTCTCATGCACTTGGTCAATACCACGCCCGCTGACCACACTGGCGACTTCCCTCTCTGTCGCCCCTCCGTGAAGTCAGACCCACTCTGCGGGCCAAGAAAGGTGACCGGGCTTCCTTCCGGCTTGCTAAGCAGAGGCCGGAAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGGACTTAACCACCACCATGTCGAGCAAAAGAACAAAGACCAAGACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCTATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGTTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCATTGGGGAAGAATCCAACTGATGAGTATCTAGATGCCATGATGAATGAGGCTCCAGGCCCCATCAATTTCACCATGTTCCTCACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAATGCCTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATACAGGAAGATTACTTGAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGATAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAATAACTTCAAATTCCAGCCAAACGTTCCTTGTTGCCACTTTGGGTATTCTGAGATTTTCTCTTGCATGCCCTTAGCTTTACAGCTTTTGCATTTCCTGTTGTATTTATTCTCAGCCATTTTGGGCATATGTATCTTTATAATCAGACTGGAAACGGGACTTTCTATTAATATCATTTTCAGAATAAAAAATAGGATAATTTAACCTACCAGCCCTTCTCCCCCAATAACTGTGGTCTATACAGAGTCAATATATTTTTTCAGAGAAAGTTATTCGCTCGATTTTTTCTGAATCATAATTAAACTTTATGATAAAATACTTACTTGTTTAAACTTCTTATTTACCAAACTTGGCTTTTGTTGGTTTCAGTCGTATCTCCCAAAGAAAGGTAGATGAGGGAAATCCTAGAAAATGATATGGTTGTTAGCTTTCTCTTCCTCCAGTTTTCCTAACAATCCTATCTCCTCTACTATCCATTCCTCCTCCTCCTCCCAAGGATATCCAATTTTAACTGCCCTAATCAGGTTTTCTGCACTTTGTCTTCCAATTTTTAAAATAATTTCCTGTAGAATTTGCATATATGATAGTTTCCATAGCTTTAAGTCCTTAAGTTGACATACCTGCCAACATTTCCAC