Transcript asmbl_61544

Sequence
Transcript Sequence for observation asmbl_61544 of TGE0056580:
CTAGAGAGATGAAGACACACGTTTAGTATTTTATTATGAATCATTATTTCAAAGTCCCATACTGCATATTCATATAAGGCAACACGGCACAATTTCAGGCTTCATCACAAAGGATGAAAAAGACTGTTTCTAACTCCCTCCTAATTTGCAGACATGCTTGAACACTTAATGGAAGGTGAAGTTTATTTTGTGGCCCCTCAGTTCTCTTTCAAGTCCTCTAGTAGAAAGTCTCCATGGTGTGATCTTCTGACTGGGTAGAACCCGCAATTCTCTGCTGTTTTTAGTCTTTGTTCCAGATGACTAATTACATGACTTGGCTGCATTTGTGAGGGGCCGACACCAACACAATTAAACCAGTGCACCATTCAGGGCCATAGGGTAGGAGGCACCAGGGTTCAAGAAGGAACTTGCGTGTTGTAGGATCTGAGTTGGGGCGGCTCTATTCCGACTATCCATCGATCTCCTCTTCCTCATCCTCAAAAGCTTCCTCCCCGTCATTGGCGGTGGCATCCTGGTACTGCTGGTACTCGGATACCAGGTCGTTCATGTTGCTCTCCGCCTCGGTGAACTCCATTTCATCCATGCCCTCACCCGTGAACCAGTGCAGGAAGGCCTTGCGCCGGAACATGGCTGAGAACTGCTCGGAGATGCGCTTGAACAGCTCCTGGATGGCCGTGCTGTTGCCGATGAAGGTGGAGGCCATCTTCAGGCCGCGGGGCGGGATGTCGCACACGGCCACCTTCACGTTGTTGGGAATCCACTCCACGAAGTAGCTGCTGTTCTTACTCTGGATGGCCAGCATCTGCTCGTCCACCTCCTTCATGGACATGGGCCCGCGGAACACGGTGGCCACGGTCAGGTAGCGGCCATGGCGCGGATCGCAGGCGGCCATCATGTTCCTGGCGTCGAACATCTGCTGGGTGAGCTCGGGCACGGTCAGGGCCCGGTACTGCTGGCTGCCGCGGCTGGTGAGCGGCGCGAAGCCAGGCATGAAGAAGTGCAGGCGCGGGAAGGGCACCATGTTCACCGCCAGCTTGCGCAGGTCAGCATTGAGCTGGCCCGGGAAGCGCAGCGAGGTGGTGACCCCACTCATGGTGGCGGACACCAGGTGGTTGAGGTCCCCGTAGGTGGGCGTTGTCAGCTTCAGAGTGCGGAAGCAGATGTCATAGAGCGCCTCGTTGTCGATGCAGTAGGTCTCGTCTGTATTCTCCACCAGCTGGTGCACCGACAGTGTGGCATTGTAGGGCTCCACCACCGTGTCCGACACCTTGGGCGAGGGCATGACGCTGAAGGTGTTCATGATGCGGTCCGGGAACTCCTCACGGATCTTGCTGATGAGCAGCGTGCCCATGCCTGAGCCCGTGCCGCCGCCCAGCGAGTGCGTGAGCTGGAAGCCCTGCAGGCAGTCGCAGTGCTCGCACTCCTTCCGCACCACGTCCAGCACTGCGTCCACCAGCTCCGCGCCCTCCGTGTAGTGCCCTTTCGCCCAGTTGTTCCCTGCACCCGTCTGGCCTGCAACAAAGAGAGTCCCGTGCCGTTTAAACAGGAAAGGGCTGCGCCATCACCATGCTTGGTCACCGACAAGGAGGGTGTGAAGTGATTCCATGATGTGCTGTTAGCCAAAGGGAGGGGCCGGGGAAACAGGCACCCACCAACGGTGCAGCTGAGCAGATGCACTGGTACGTTTTTAGGCAAGTCAAAGTAGCTACTGGTCAATTTTAAAGATGTATATACATTTTGACCTGGTTGTTCCATGTTAAAGAGGTAATTCTTGCACATGGTAGAATTCAAAGGGAACAAAAGGTATACATTAAAAAAATAAGTTACTGG