Transcript asmbl_59985

Sequence
Transcript Sequence for observation asmbl_59985 of TGE0057044:
TTCCTGGCCCCTCTGGTGAACCTGGCAAACAAGGTCCCTCTGGAGCAAGTGGTGAACGTGGTCCCCCTGGTCCCATGGGCCCCCCTGGATTGGCTGGACCCCCTGGTGAATCTGGACGTGAGGGGGCTCCTGGTGCCGAAGGTTCCCCTGGACGAGACGGTTCTCCTGGCGCCAAGGGTGACCGTGGTGAGACCGGCCCCGCTGGACCCCCTGGTGCTCCTGGTGCTCCTGGTGCCCCTGGCCCCGTTGGCCCTGCTGGCAAGAGTGGTGATCGTGGTGAGACTGTAAGTAGCTGGGCTCCAGTTCCCTGTACCTGGTCAGGCCAGGGACTCTTCAGGCCTCCTTAGAGGCCTGGGGATGGGTGTCGGACTTCACCCAGGCAGGGGGAGGAAAGGAGATCCTGCAAGATGTCAGGGCCTTAATCCAAAAAACTGAGTTAAAGCTCAGCCCCAAGTCCCCTCTCCCAGACAGGACCGCCTCTCCCATGAGTTGGCCCCAGCTCCCGTGAAGATTGCAGTGGGGAGGTTTCCCTGGGAGTTGGGAGAGATGGCCACAGTGGGAAGCAGCTGAGGAGAGAGAGATCCAGCAGAGGGGAGGCCTCATCCTGCAGCCCCAGCCTCAGCCTTCCCTGGCCAAGAGCTCATGCTTTCCTTGCTCTCCCCAGGGTCCTGCTGGTCCCGCCGGTCC