Transcript asmbl_59803

Sequence
Transcript Sequence for observation asmbl_59803 of TGE0056816:
CAGCAGTTCTGGCCGCTGTCCCGGTGCGCACGGACGTGGCTCGAGTTTCCTCTGCTCTCCGCTCTCGCCCGCTAGCTCTCCTCCCTTCCGCTCCTGCTTCTCTCCGGGTCTCCCGCTCCAGCTCCAGCCCCACCCGGCCGGTCCCGCACGGCTCCGGGTAGCCATGGAGGACCCCACGCTCTATATTGTCGAGCGGCCGCTTCCCGGGTACCCCGACGCCGAGGCCCCGGAGCCTTCCTCCGCTGGGGCTCAGGCAGCGGAGGAGCCGTCGGGGGCCGGCTCAGAAGAGCTGATCAAGTCGGACCAGGTGAACGGCGTGCTGGTGCTGAGCCTCCTGGACAAAATCATCGGGGCCGTAGACCAGATCCAGCTGACTCAAGCACAGCTGGAGGAGCGGCAGGCGGAGATGGAGGGCGCAGTGCAGAGCATCCAGGGCGAGCTGAGCAAGCTGGGCAAGGCGCACGCCACCACGAGCAATACGGTGAGCAAGCTGCTGGAGAAGGTGCGCAAGGTCAGCGTCAACGTGAAGACCGTGCGCGGCAGCCTGGAGCGCCAGGCGGGGCAGATCAAGAAGCTGGAGGTCAACGAGGCCGAGCTGCTGCGGCGCCGCAACTTTAAAGTCATGATCTACCAGGATGAAGTGAAGCTGCCGGCCAAACTGAGCATCAGCAAATCGCTGAAAGAGTCGGAGGCGCTGCCAGAGAAGGAGGGCGAGGAGCTGGGCGAGGGCGAGCGGCCCGAGGAGGACGCAGCGGCGCTGGAGCTTTCGTCGGACGAGGCGGTGGAGGTTGAGGAGGTTATTGAGGAGTCCCGCGCAGAGCGTATCAAGCGCAGCGGCCTGCGGCGCGTGGACGACTTCAAGAAGGCCTTCTCCAAGGAGAAGATGGAGAAGACCAAGGTGCGTACCCGCGAGAACCTGGAGAAGACGCGCCTCAAGACCAAGGAAAACCTGGAGAAGACGCGGCACACCCTGGAGAAGCGCATGAACAAGCTGGGCACGCGCCTGGTGCCCGCCGAGCGGCGCGAGAAACTGAAGACGTCGCGGGACAAGTTGCGCAAATCCTTCACGCCCGACCACGTGGTGTACGCGCGCTCCAAGACCGCGGTCTACAAGGTGCCACCCTTCACCTTCCACGTCAAGAAGATCCGCGAGGGCCAGGTGGAAGTGCTCAAGGCCACCGAGATGGTGGAGGTGGGCGCCGACGACGACGAGGGCGGCGCGGAGCGCGGGGAGGCCGGCGACCTGCGGCGCGGGAGCAGCCCCGACGTGCACGCGCTGCTGGAGATCACCGAGGAGTCGGACGCCGTGCTGGTGGACAAGAGCGACAGCGACTGAGCCGCCCCCGCTGCCACCCACCCCATTCCTCGCTCCTTCCGAACTTCCTCTTTCGCATTCTCTCTCGGCTCGAGCTGGCTGAGATTTTTCTAAATTGAAAACACGCCCCCCTCCCCACACCTCCAGGAACTCCACTCCCAGTCTTAGAGCTGTTAGGACCCGATGGGGAGGCAGCCCCCGCAGTGGACAACCCCCGCTTGGACACAGTCCGAGTGGAATGGGAAGGGAATGGTCAATCCCTGTCCTGGTTGTCCAAGTCGGGATCTCAGAGGAAATTGCAGTGATTCCACGGTTAGGCCCCCCTGGGGGGGCTGCCTTCCCCTCAGCCTCTCCCCACACCACCCACCCAGCTGCTGTCATTCCGCTCACTGAGCTCTTCTTCATTCTCACCCTGATCCCTGGGGGACTCAAAGCCAAAACTGCCCAAAGAGGAAAGATTGAATCCTAAAGGGGATCCCTGCCCCCATGGGAGGCCCCCTACTAGAAGGACGTGAAAGCAGCTTTTGGGGGAAACTGAGGCAGTGGGGAAGACAGAGCAGAATGAGCCCTCACCCTGGCTGGGGGTCCAGCACAGGCTGTATCTGCAGAGGGTCCCAGAGGAACGCTGGAGCCAAGAGAAGCCCTGGGAAGGAGGGGTGGGGAACGACATGCATGTGAGGGATGGCACACTGATGTGTTTATGCACCTGTACACAGGAGCGCATGGCCATGGCTTTGGAAAGGAGAATGGAAAAATAGAAGAAGGTCGGCCGGGCTTGGTGGCTTATGCCTGTAACCCCAGCACTTTGGGAGGCCGAGGTGGGCGGATCACCTGAAGTCAGGAGTTCGGGACCAGCCTGGCAAACA