Transcript asmbl_59802

Sequence
Transcript Sequence for observation asmbl_59802 of TGE0056816:
CAGCAGTTCTGGCCGCTGTCCCGGTGCGCACGGACGTGGCTCGAGTTTCCTCTGCTCTCCGCTCTCGCCCGCTAGCTCTCCTCCCTTCCGCTCCTGCTTCTCTCCGGGTCTCCCGCTCCAGCTCCAGCCCCACCCGGCCGGTCCCGCACGGCTCCGGGTAGCCATGGAGGACCCCACGCTCTATATTGTCGAGCGGCCGCTTCCCGGGTACCCCGACGCCGAGGCCCCGGAGCCTTCCTCCGCTGGGGCTCAGGCAGCGGAGGAGCCGTCGGGGGCCGGCTCAGAAGAGCTGATCAAGTCGGACCAGGTGAACGGCGTGCTGGTGCTGAGCCTCCTGGACAAAATCATCGGGGCCGTAGACCAGATCCAGCTGACTCAAGCACAGCTGGAGGAGCGGCAGGCGGAGATGGAGGGCGCAGTGCAGAGCATCCAGGGCGAGCTGAGCAAGCTGGGCAAGGCGCACGCCACCACGAGCAATACGGTGAGCAAGCTGCTGGAGAAGGTGCGCAAGGTCAGCGTCAACGTGAAGACCGTGCGCGGCAGCCTGGAGCGCCAGGCGGGGCAGATCAAGAAGCTGGAGGTCAACGAGGCCGAGCTGCTGCGGCGCCGCAACTTTAAAGTCATGATCTACCAGGATGAAGTGAAGCTGCCGGCCAAACTGAGCATCAGCAAATCGCTGAAAGAGTCGGAGGCGCTGCCAGAGAAGGAGGGCGAGGAGCTGGGCGAGGGCGAGCGGCCCGAGGAGGACGCAGCGGCGCTGGAGCTTTCGTCGGACGAGGCGGTGGAGGTTGAGGAGGTTATTGAGGAGTCCCGCGCAGAGCGTATCAAGCGCAGCGGCCTGCGGCGCGTGGACGACTTCAAGAAGGCCTTCTCCAAGGAGAAGATGGAGAAGACCAAGGTGCGTACCCGCGAGAACCTGGAGAAGACGCGCCTCAAGACCAAGGAAAACCTGGAGAAGACGCGGCACACCCTGGAGAAGCGCATGAACAAGCTGGGCACGCGCCTGGTGCCCGCCGAGCGGCGCGAGAAACTGAAGACGTCGCGGGACAAGTTGCGCAAATCCTTCACGCCCGACCACGTGGTGTACGCGCGCTCCAAGACCGCGGTCTACAAGGTGCCACCCTTCACCTTCCACGTCAAGAAGATCCGCGAGGGCCAGGTGGAAGTGCTCAAGGCCACCGAGATGGTGGAGGTGGGCGCCGACGACGACGAGGGCGGCGCGGAGCGCGGGGAGGCCGGCGACCTGCGGCGCGGGAGCAGCCCCGACGTGCACGCGCTGCTGGAGATCACCGAGGAGTCGGACGCCGTGCTGGTGGACAAGAGCGACAGCGACTGAGCCGCCCCCGCTGCCACCCACCCCATTCCTCGCTCCTTCCGAACTTCCTCTTTCGCATTCTCTCTCGGCTCGAGCTGGCTGAGATTTTTCTAAATTGAAAACACGCCCCCCTCCCCACACCTCCAGGAACTCCACTCCCAGTCTTAGAGCTGTTAGGACCCGATGGGGAGGCAGCCCCCGCAGTGGACAACCCCCGCTTGGACACAGTCCGAGTGGAATGGGAAGGGAATGGTCAATCCCTGTCCTGGTTGTCCAAGTCGGGATCTCAGAGGAAATTGCAGTGATTCCACGGTTAGGCCCCCCTGGGGGGGCTGCCTTCCCCTCAGCCTCTCCCCACACCACCCACCCAGCTGCTGTCATTCCGCTCACTGAGCTCTTCTTCATTCTCACCCTGATCCCTGGGGGACTCAAAGCCAAAACTGCCCAAAGAGGAAAGATTGAATCCTAAAGGGGATCCCTGCCCCCATGGGAGGCCCCCTACTAGAAGGACGTGAAAGCAGCTTTTGGGGGAAACTGAGGCAGTGGGGAAGACAGAGCAGAATGAGCCCTCACCCTGGCTGGGGGTCCAGCACAGGCTGTATCTGCAGAGGGTCCCAGAGGAACGCTGGAGCCAAGAGAAGCCCTGGGAAGGAGGGGTGGGGAACGACATGCATGTGAGGGATGGCACACTGATGTGTTTATGCACCTGTACACAGGAGCGCATGGCCATGGCTTTGGAAAGGAGAATGGAAAAATAGAAGAAGGTCGGCCGGGCTTGGTGGCTTATGCCTGTAACCCCAGCACTTTGGGAGGCCGAGGTGAGCGGATCACTTGAGGTCAGGAGTTTGAGACCAGCCTGGCCAACATGGT