Transcript asmbl_59530

Sequence
Transcript Sequence for observation asmbl_59530 of TGE0056264:
GGAGGGGGCAGAGGGGATGGGCTGGAGGTTGAGCAAACAGAGCAGCAGAAAAGGCAGTTCCTCTTCTCCAGTGCCCTCCTTCCCTGTCTCTGCCTCTCCCTCCCTTCCTCAGGCATCAGAGCGGAGACTTCAGGGAGACCAGAGCCCAGCTTGCCAGGCACTGAGCTAGAAGCCCTGCCATGGCACCCCTGAGACCCCTTCTCATACTGGCCCTGCTGGCATGGGTTGCTCTGGCTGACCAAGAGTCATGCAAGGGCCGCTGCACTGAGGGCTTCAACGTGGACAAGAAGTGCCAGTGTGACGAGCTCTGCTCTTACTACCAGAGCTGCTGCACAGACTATACGGCTGAGTGCAAGCCCCAAGTGACTCGCGGGGATGTGTTCACTATGCCGGAGGATGAGTACACGGTCTATGACGATGGCGAGGAGAAAAACAATGCCACTGTCCATGAACAGGTGGGGGGCCCCTCCCTGACCTCTGACCTCCAGGCCCAGTCCAAAGGGAATCCTGAGCAGACACCTGTTCTGAAACCTGAGGAAGAGGCCCCTGCGCCTGAGGTGGGCGCCTCTAAGCCTGAGGGGATAGACTCAAGGCCTGAGACCCTTCATCCAGGGAGACCTCAGCCCCCAGCAGAGGAGGAGCTGTGCAGTGGGAAGCCCTTCGACGCCTTCACCGACCTCAAGAACGGTTCCCTCTTTGCCTTCCGAGGGCAGTACTGCTATGAACTGGACGAAAAGGCAGTGAGGCCTGGGTACCCCAAGCTCATCCGAGATGTCTGGGGCATCGAGGGCCCCATCGATGCCGCCTTCACCCGCATCAACTGTCAGGGGAAGACCTACCTCTTCAAGGGTAGTCAGTACTGGCGCTTTGAGGATGGTGTCCTGGACCCTGATTACCCCCGAAATATCTCTGACGGCTTCGATGGCATCCCGGACAACGTGGATGCAGCCTTGGCCCTCCCTGCCCATAGCTACAGTGGCCGGGAGCGGGTCTACTTCTTCAAGGGGAAACAGTACTGGGAGTACCAGTTCCAGCACCAGCCCAGTCAGGAGGAGTGTGAAGGCAGCTCCCTGTCGGCTGTGTTTGAACACTTTGCCATGATGCAGCGGGACAGCTGGGAGGACATCTTCGAGCTTCTCTTCTGGGGCAGAACCTCTGCTGGTACCAGACAGCCCCAGTTCATTAGCCGGGACTGGCACGGTGTGCCAGGGCAAGTGGACGCAGCCATGGCTGGCCGCATCTACATCTCAGGCATGGCACCCCGCCCCTCCTTGGCCAAGAAACAAAGGTTTAGGCATCGCAACCGCAAAGGCTACCGTTCACAACGAGGCCACAGCCGTGGCCGCAACCAGAACTCCCGCCGGCCATCCCGCGCCACGTGGCTGTCCTTGTTCTCCAGTGAGGAGAGCAACTTGGGAGCCAACAACTATGATGACTACAGGATGGACTGGCTTGTGCCTGCCACCTGTGAACCCATCCAGAGTGTCTTCTTCTTCTCTGGAGACAAGTACTACCGAGTCAATCTTCGCACACGGCGAGTGGACACTGTGGACCCTCCCTACCCACGCTCCATCGCTCAGTACTGGCTGGGCTGCCCAGCTCCTGGCCATCTGTAGGAGTCAGAGCCCACATGGCCGGGCCCTCTGTAGCTCCCTCCTCCCATCTCCTTCCCCCAGCCCAATAAAGGTCCCTTAGCCCCGAGT