Transcript asmbl_59399

Sequence
Transcript Sequence for observation asmbl_59399 of TGE0056568:
CCAATGAGGGTAGGGGTGGGTGGGGCAGCCCCGAGCAGCAGTGCTAAAGGAGCCCGGCGGAGGCAGCGGTGGGTTTGGGACTGAGGCGCTGGATCTGTGGTCGCGGCTGGGGACGTGCGCCCGCGCCACCATCTTCGGCTGAAGAGGCAATTGCTTTTGGATCGTTCCATTTACAATGGCGCAGAGAACTGGACTCGAGGATCCAGAGAGGTATCTCTTTGTGGACAGGGCTGTCATCTACAACCCTGCCACTCAAGCTGATTGGACAGCTAAAAAGCTAGTGTGGATTCCATCAGAACGCCATGGTTTTGAGGCAGCTAGTATCAAAGAAGAACGGGGAGATGAAGTTATGGTGGAGTTGGCAGAGAATGGAAAGAAAGCAATGGTCAACAAAGATGATATTCAGAAGATGAACCCACCTAAGTTTTCCAAGGTGGAGGATATGGCAGAATTGACATGCTTGAATGAAGCTTCCGTTTTACATAATCTGAAGGATCGCTACTATTCAGGACTAATCTATACTTATTCTGGACTCTTCTGTGTAGTTATAAACCCTTACAAGAATCTTCCAATTTACTCTGAGAATATTATTGAAATGTACAGAGGGAAGAAGCGTCATGAGATGCCTCCACACATCTATGCTATATCTGAATCTGCTTACAGATGCATGCTTCAAGATCGTGAGGACCAGTCAATTCTTTGCACGGGTGAGTCAGGTGCTGGGAAGACAGAAAATACAAAGAAAGTTATTCAGTACCTTGCCCATGTTGCTTCTTCACATAAAGGAAGAAAGGACCATAATATTCCTGGGGAACTTGAACGGCAGCTTTTGCAAGCAAATCCAATTCTGGAATCATTTGGAAATGCGAAGACTGTGAAAAATGATAACTCATCTCGTTTTGGCAAATTTATTCGGATCAACTTTGATGTAACTGGCTATATCGTTGGGGCCAACATTGAAACATACCTTCTGGAAAAGTCTCGTGCTGTTCGTCAAGCAAAAGATGAACGTACTTTTCATATCTTTTACCAGTTGTTATCTGGAGCAGGAGAACACCTAAAGTCTGATTTGCTTCTTGAAGGATTTAATAACTACAGGTTTCTCTCCAATGGCTATATTCCTATTCCGGGACAGCAAGACAAAGATAATTTCCAGGAGACCATGGAAGCAATGCACATAATGGGCTTCTCCCATGAAGAGATTCTGTCAATGCTTAAAGTAGTATCTTCAGTGCTACAGTTTGGAAATATTTCTTTCAAAAAGGAGAGAAATACTGATCAAGCTTCCATGCCAGAAAATACAGTTGCGCAGAAGCTCTGCCATCTTCTTGGGATGAATGTGATGGAGTTTACTCGGGCCATCCTGACTCCCCGGATCAAGGTCGGCCGAGACTATGTGCAAAAAGCCCAGACCAAAGAACAGGCAGATTTTGCAGTAGAAGCATTGGCAAAAGCTACCTATGAGCGGCTCTTTCGCTGGCTCGTTCATCGCATCAATAAAGCTCTGGATAGGACCAAACGTCAGGGAGCATCTTTCATTGGAATCCTGGATATTGCTGGATTTGAAATTTTTGAGCTGAACTCCTTTGAACAACTTTGCATCAACTACACCAATGAGAAGCTGCAGCAGCTGTTCAACCACACCATGTTTATCCTAGAACAAGAGGAATACCAGCGCGAAGGCATCGAGTGGAACTTCATCGATTTCGGGCTGGATCTGCAGCCATGCATCGACCTAATAGAGAGACCTGCGAACCCTCCTGGTGTACTGGCCCTTTTGGATGAAGAATGCTGGTTCCCTAAAGCCACAGATAAAACCTTTGTTGAAAAACTGGTTCAAGAGCAAGGTTCCCACTCCAAGTTTCAGAAACCTCGACAATTAAAAGACAAAGCTGATTTTTGCATTATACATTATGCAGGGAAGGTGGACTATAAGGCAGATGAGTGGCTGATGAAGAATATGGACCCCCTGAATGACAACGTGGCCACCCTTTTGCACCAGTCATCAGACAGATTTGTGGCAGAGCTTTGGAAAGATGTGGACCGTATCGTGGGTCTGGATCAAGTCACTGGTATGACTGAGACAGCTTTTGGCTCCGCATATAAAACCAAGAAGGGCATGTTTCGTACCGTTGGGCAACTCTACAAAGAATCTCTCACCAAGCTGATGGCAACTCTCCGAAACACCAACCCTAACTTTGTTCGTTGTATCATTCCAAATCACGAGAAGAGGGCTGGAAAATTGGATCCACACCTAGTCCTAGATCAGCTTCGCTGTAACGGTGTCCTGGAAGGGATCCGAATCTGTCGCCAGGGCTTCCCTAACCGAATAGTTTTCCAGGAATTCAGACAGAGATATGAGATCCTAACTCCAAATGCTATTCCTAAAGGTTTTATGGATGGTAAACAGGCCTGTGAACGAATGATCCGGGCTTTAGAATTGGACCCAAACTTGTACAGAATTGGACAGAGCAAGATATTTTTCAGAGCTGGAGTTCTGGCACACTTAGAGGAAGAAAGAGATTTAAAAATCACCGATATCATTATCTTCTTCCAGGCCGTTTGCAGAGGTTACCTGGCCAGAAAGGCCTTTGCCAAGAAGCAGCAGCAACTAAGTGCCTTAAAGGTCTTGCAGCGGAACTGTGCCGCGTACCTGAAATTACGGCACTGGCAGTGGTGGCGAGTCTTCACAAAGGTGAAGCCGCTTCTACAAGTGACTCGCCAGGAGGAAGAACTTCAGGCCAAAGATGAAGAGCTGTTGAAGGTGAAGGAGAAGCAGACGAAGGTGGAAGGAGAGCTGGAGGAGATGGAGCGGAAGCACCAGCAGCTTTTAGAAGAGAAGAATATCCTTGCAGAACAACTACAAGCAGAGACTGAGCTCTTTGCTGAAGCAGAAGAGATGAGGGCAAGACTTGCTGCTAAAAAGCAGGAATTAGAAGAGATTCTACATGACTTGGAGTCTAGGGTTGAAGAAGAAGAAGAAAGAAACCAAATCCTCCAAAATGAAAAGAAAAAAATGCAAGCACATATTCAGGACCTGGAAGAACAGCTAGACGAGGAGGAAGGGGCTCGGCAAAAGCTGCAGCTGGAAAAGGTGACAGCAGAGGCCAAGATCAAGAAGATGGAAGAGGAGATTCTGCTTCTCGAGGACCAAAATTCCAAGTTCATCAAAGAAAAGAAACTCATGGAAGATCGCATTGCTGAGTGTTCCTCTCAGCTGGCTGAAGAGGAAGAAAAGGCGAAAAACTTGGCCAAAATCAGGAATAAGCAAGAAGTGATGATCTCAGATTTAGAAGAACGCTTAAAGAAGGAAGAAAAGACTCGTCAGGAACTGGAAAAGGCCAAAAGAAAACTCGACGGGGAGACGACCGACCTGCAGGACCAGATCGCAGAGCTGCAGGCGCAGATTGATGAGCTCAAGCTGCAGCTGGCCAAGAAGGAGGAGGAGCTGCAGGGCGCACTGGCCAGAGGTGATGATGAAACACTCCATAAGAACAATGCCCTTAAAGTTGTGCGAGAGCTACAAGCCCAAATTGCTGAACTTCAGGAAGACTTTGAATCCGAGAAGGCTTCACGGAACAAGGCCGAAAAGCAGAAAAGGGACTTGAGTGAGGAACTGGAAGCTCTGAAAACAGAGCTGGAGGACACGCTGGACACCACGGCAGCCCAGCAGGAACTACGTACAAAACGTGAACAAGAAGTGGCAGAGCTGAAGAAAGCTCTTGAGGAGGAAACTAAGAACCATGAAGCTCAAATCCAGGACATGAGACAAAGACACGCAACAGCCCTGGAGGAGCTCTCAGAGCAGCTGGAACAGGCCAAGCGGTTCAAAGCAAATCTAGAGAAGAACAAGCAGGGCCTGGAGACAGATAACAAGGAGCTGGCGTGTGAGGTGAAGGTCCTGCAGCAGGTCAAGGCTGAGTCTGAGCACAAGAGGAAGAAGCTCGACGCGCAGGTCCAGGAGCTCCATGCCAAGGTCTCTGAAGGCGACAGGCTCAGGGTGGAGCTGGCGGAGAAAGCAAGTAAGCTGCAGAATGAGCTAGATAATGTCTCCACCCTTCTGGAAGAAGCAGAGAAGAAGGGTATTAAATTTGCTAAGGATGCAGCTAGTCTTGAGTCTCAACTACAGGATACACAGGAGCTTCTTCAGGAGGAGACACGCCAGAAACTAAACCTGAGCAGTCGGATCCGGCAGCTGGAAGAGGAGAAGAACAGTCTTCAGGAGCAGCAGGAGGAGGAGGAGGAGGCCAGGAAGAACCTGGAGAAGCAAGTGCTGGCCCTGCAGTCCCAGTTGGCTGATACCAAGAAGAAAGTAGATGACGACCTGGGAACAATTGAAAGTCTGGAAGAAGCCAAGAAGAAGCTTCTGAAGGACGCGGAGGCCCTGAGCCAGCGCCTGGAGGAGAAGGCACTGGCGTATGACAAACTGGAGAAGACCAAGAACCGCCTGCAGCAGGAGCTGGACGACCTCACGGTGGACCTGGACCACCAGCGCCAGGTCGCCTCCAACTTGGAGAAGAAGCAGAAGAAGTTTGACCAGCTGTTAGCAGAAGAGAAGAGCATCTCTGCTCGCTATGCCGAAGAGCGGGACCGGGCCGAAGCCGAGGCCAGAGAGAAAGAAACCAAAGCCCTGTCACTGGCCCGGGCCCTCGAGGAAGCCCTGGAGGCCAAGGAGGAGTTTGAGAGGCAGAACAAGCAGCTCCGAGCAGACATGGAAGACCTCATGAGCTCCAAAGATGATGTGGGAAAAAACGTTCACGAACTTGAAAAATCCAAACGGGCCCTAGAGCAGCAGGTGGAGGAAATGAGGACCCAGCTGGAGGAGCTGGAAGACGAACTCCAGGCCACGGAAGATGCCAAGCTTCGTCTGGAGGTCAACATGCAGGCCATGAAGGCGCAGTTCGAGAGAGACCTGCAAACCAGGGATGAGCAGAATGAAGAGAAGAAGCGGCTGCTGATCAAACAGGTGCGGGAGCTCGAGGCGGAGCTGGAGGATGAGAGGAAACAGCGGGCGCTTGCTGTAGCTTCAAAGAAAAAGATGGAGATAGACCTGAAGGACCTCGAAGCCCAAATCGAGGCTGCGAACAAAGCTCGGGATGAGGTGATTAAGCAGCTCCGCAAGCTCCAGGCTCAGATGAAGGATTACCAACGTGAATTAGAAGAAGCTCGTGCATCCAGAGATGAGATTTTTGCTCAATCCAAAGAGAGTGAAAAGAAATTGAAGAGTCTGGAAGCAGAAATCCTTCAATTGCAGGAGGAACTTGCCTCATCTGAGCGAGCCCGCCGACACGCCGAGCAGGAGAGAGATGAGCTGGCGGACGAGATCACCAACAGCGCCTCTGGCAAGTCCGCGCTGCTGGATGAGAAGCGGCGTCTGGAAGCTCGGATCGCACAGCTGGAGGAGGAGCTGGAAGAGGAGCAGAGCAACATGGAGCTGCTCAACGACCGCTTCCGCAAGACCACTCTACAGGTGGACACACTGAACGCCGAGCTAGCAGCCGAGCGCAGCGCCGCCCAGAAGAGTGACAATGCACGCCAGCAACTGGAGCGGCAGAACAAGGAGCTGAAGGCCAAGCTGCAGGAACTCGAGGGTGCTGTCAAGTCTAAGTTCAAGGCCACCATCTCAGCCCTGGAGGCCAAGATTGGGCAGCTGGAGGAGCAGCTTGAGCAGGAAGCCAAGGAACGAGCAGCCGCCAACAAATTAGTCCGTCGCACTGAGAAGAAGCTGAAAGAAATCTTCATGCAGGTTGAGGATGAGCGTCGACACGCGGACCAGTATAAAGAGCAGATGGAGAAGGCCAACGCTCGGATGAAGCAGCTTAAACGCCAGCTGGAGGAAGCAGAAGAAGAAGCGACGCGTGCCAACGCATCTCGGCGTAAACTCCAGCGGGAACTGGATGATGCCACCGAGGCCAACGAGGGCCTGAGCCGCGAGGTCAGCACCCTGAAGAACCGGCTGAGGCGGGGTGGCCCCATCAGCTTCTCTTCCAGCCGATCTGGCCGGCGCCAGCTGCACCTTGAAGGAGCTTCCCTGGAGCTCTCCGACGATGACACAGAAAGTAAGACCAGTGATGTCAACGAGACGCAGCCACCCCAGTCAGAGTAAAGTTGCAGGAAGCCAGAGGAGGCAATACAGTGGGACAGTTAGGAATGCACCCGGGGCCTCCTGCAGATTTCGGAAATTGGCAAGCTACGGGATTCCTTCCTGAAAGATCAACTGTGTCTTAAGGCTCTCCAGCCTATGCATACTGTATCCTGCTTCAGACTTAGGTACAATTGCTCCCCTTTTTATATATAGACACACACAGGACACATATATTAAACAGATTGTTTCATCATTGCATCTATTTTCCATATAGTCATCAAGAGACCATTTTATAAAACATGGTAAGACCCTTTTTAAAACAAACTCCAGGCCCTTGGTTGCGGGTCGCTGGGTTATTGGGGCAGCGCCGTGGTCGTCACTCAGTCGCTCTGCATGCTCTCTGTCATACAGACAGGTAACCTAGTTCTGTGTTCACGTGGCCCCCGACTCCTCAGCCACATCAAGTCTCCTAGACCACTGTGGACTCTAAACTGCACTTGTCTCTCTCATTTCCTTCAAATAATGATCAATGCTATTTCAGTGAGCAAACTGTGAAAGGGGCTTTGGAAAGAGTAGGAGGGGTGGGCTGGATCGGAAGCAACACCCATTTGGGGTTACCATGTCCATCCCCCAAGGGGGGCCCTGCCCCTCGAGTCGATGGTGTCCCGCATCTACTCATGTGAACTGGCCTTGGCGAGGGCTGGTCTGTGCATAGAAGGGATAGTGGCCACACTGCAGCTGAGGCCCCAGGTGGCAGCCATGGATCATGTAGACTTCCAGATGGTCTCCCGAACCGCCTGGCTCTGCCGGCGCCCTCCTCACGTCAGGAGCAAGCAGCCGTGGACCCCTAAGCCGAGCTGGTGGAAGGCCCCTCCCCATCGCCAGCCGGGCCCTCATGCTGACCTTGCAAATTCAGCCGCTGCTTTGAGCCCAAAATGGGAATATTGGTTTTGTGTCCGAGGCTTGTTCCAAGTTTGTCAATGAGGTTTATGGAGCCTCCAGAACAGATGCCATCTTCCTGAATGTTGACATGCCAGTGGGTGTGACTCCTTCATTTTTCCTTCTCCCTTCCCTTTGGACAGTGTTACAGTGAACACTTAGCATCCTGTTTTTGGTTGGTAGTTAAGCAAACTGACATTACGGAAAGTGCCTTAGACACTACAGTACTAAGACAATGTTGAATATATCATTCGCCTCTATAACAATTTAATGTATTCAGTTTTGACTGTGCTTCATATCATGTACCTCTCTAGTCAAAGTGGTATTACAGACATTCAGTGACAATGAATCAGTGTTAATTCTAAATCCTTGATCCTCTGCAATGTGCTTGAAAACACAAACCTTTTGGGTTAAAAGCTTTAACATCTATTAGGAAGAATTTGTCCTGTGGGTTTGGAATCTTGGATTTTCCCCCTTTATGAACTGTACTGGCTGTTGACCACCAGACACCTGACCGCAAATATCTTTTCTTGTATTCCCATATTTCTAGACAATGATTTTTGTAAGACAATAAATTTATTCATTATAGATATTTGCGCCTGCTCTGTTTACTTGAAGAAAAAAGCACCCGTGGAGAATAAAGAGACCTCAATAAACAAGAATAATCATGTGAACGTGG