Transcript asmbl_59397

Sequence
Transcript Sequence for observation asmbl_59397 of TGE0056568:
CCAATGAGGGTAGGGGTGGGTGGGGCAGCCCCGAGCAGCAGTGCTAAAGGAGCCCGGCGGAGGCAGCGGTGGGTTTGGGACTGAGGCGCTGGATCTGTGGTCGCGGCTGGGGACGTGCGCCCGCGCCACCATCTTCGGCTGAAGTAACTGAGGGCAAACCCATCAGACAACCAGAGCCATAATTTGTGGTCACCGCTGAAATTTACCTTGGAAACTCGAGGCAATTGCTTTTGGATCGTTCCATTTACAATGGCGCAGAGAACTGGACTCGAGGATCCAGAGAGGTATCTCTTTGTGGACAGGGCTGTCATCTACAACCCTGCCACTCAAGCTGATTGGACAGCTAAAAAGCTAGTGTGGATTCCATCAGAACGCCATGGTTTTGAGGCAGCTAGTATCAAAGAAGAACGGGGAGATGAAGTTATGGTGGAGTTGGCAGAGAATGGAAAGAAAGCAATGGTCAACAAAGATGATATTCAGAAGATGAACCCACCTAAGTTTTCCAAGGTGGAGGATATGGCAGAATTGACATGCTTGAATGAAGCTTCCGTTTTACATAATCTGAAGGATCGCTACTATTCAGGACTAATCTATACTTATTCTGGACTCTTCTGTGTAGTTATAAACCCTTACAAGAATCTTCCAATTTACTCTGAGAATATTATTGAAATGTACAGAGGGAAGAAGCGTCATGAGATGCCTCCACACATCTATGCTATATCTGAATCTGCTTACAGATGCATGCTTCAAGATCGTGAGGACCAGTCAATTCTTTGCACGGGTGAGTCAGGTGCTGGGAAGACAGAAAATACAAAGAAAGTTATTCAGTACCTTGCCCATGTTGCTTCTTCACATAAAGGAAGAAAGGACCATAATATTCCTGGGGAACTTGAACGGCAGCTTTTGCAAGCAAATCCAATTCTGGAATCATTTGGAAATGCGAAGACTGTGAAAAATGATAACTCATCTCGTTTTGGCAAATTTATTCGGATCAACTTTGATGTAACTGGCTATATCGTTGGGGCCAACATTGAAACATACCTTCTGGAAAAGTCTCGTGCTGTTCGTCAAGCAAAAGATGAACGTACTTTTCATATCTTTTACCAGTTGTTATCTGGAGCAGGAGAACACCTAAAGTCTGATTTGCTTCTTGAAGGATTTAATAACTACAGGTTTCTCTCCAATGGCTATATTCCTATTCCGGGACAGCAAGACAAAGATAATTTCCAGGAGACCATGGAAGCAATGCACATAATGGGCTTCTCCCATGAAGAGATTCTGTCAATGCTTAAAGTAGTATCTTCAGTGCTACAGTTTGGAAATATTTCTTTCAAAAAGGAGAGAAATACTGATCAAGCTTCCATGCCAGAAAATACAGTTGCGCAGAAGCTCTGCCATCTTCTTGGGATGAATGTGATGGAGTTTACTCGGGCCATCCTGACTCCCCGGATCAAGGTCGGCCGAGACTATGTGCAAAAAGCCCAGACCAAAGAACAGGCAGATTTTGCAGTAGAAGCATTGGCAAAAGCTACCTATGAGCGGCTCTTTCGCTGGCTCGTTCATCGCATCAATAAAGCTCTGGATAGGACCAAACGTCAGGGAGCATCTTTCATTGGAATCCTGGATATTGCTGGATTTGAAATTTTTGAGCTGAACTCCTTTGAACAACTTTGCATCAACTACACCAATGAGAAGCTGCAGCAGCTGTTCAACCACACCATGTTTATCCTAGAACAAGAGGAATACCAGCGCGAAGGCATCGAGTGGAACTTCATCGATTTCGGGCTGGATCTGCAGCCATGCATCGACCTAATAGAGAGACCTGCGAACCCTCCTGGTGTACTGGCCCTTTTGGATGAAGAATGCTGGTTCCCTAAAGCCACAGATAAAACCTTTGTTGAAAAACTGGTTCAAGAGCAAGGTTCCCACTCCAAGTTTCAGAAACCTCGACAATTAAAAGACAAAGCTGATTTTTGCATTATACATTATGCAGGGAAGGTGGACTATAAGGCAGATGAGTGGCTGATGAAGAATATGGACCCCCTGAATGACAACGTGGCCACCCTTTTGCACCAGTCATCAGACAGATTTGTGGCAGAGCTTTGGAAAGATGTGGACCGTATCGTGGGTCTGGATCAAGTCACTGGTATGACTGAGACAGCTTTTGGCTCCGCATATAAAACCAAGAAGGGCATGTTTCGTACCGTTGGGCAACTCTACAAAGAATCTCTCACCAAGCTGATGGCAACTCTCCGAAACACCAACCCTAACTTTGTTCGTTGTATCATTCCAAATCACGAGAAGAGGGCTGGAAAATTGGATCCACACCTAGTCCTAGATCAGCTTCGCTGTAACGGTGTCCTGGAAGGGATCCGAATCTGTCGCCAGGGCTTCCCTAACCGAATAGTTTTCCAGGAATTCAGACAGAGATATGAGATCCTAACTCCAAATGCTATTCCTAAAGGTTTTATGGATGGTAAACAGGCCTGTGAACGAATGATCCGGGCTTTAGAATTGGACCCAAACTTGTACAGAATTGGACAGAGCAAGATATTTTTCAGAGCTGGAGTTCTGGCACACTTAGAGGAAGAAAGAGATTTAAAAATCACCGATATCATTATCTTCTTCCAGGCCGTTTGCAGAGGTTACCTGGCCAGAAAGGCCTTTGCCAAGAAGCAGCAGCAACTAAGTGCCTTAAAGGTCTTGCAGCGGAACTGTGCCGCGTACCTGAAATTACGGCACTGGCAGTGGTGGCGAGTCTTCACAAAGGTGAAGCCGCTTCTACAAGTGACTCGCCAGGAGGAAGAACTTCAGGCCAAAGATGAAGAGCTGTTGAAGGTGAAGGAGAAGCAGACGAAGGTGGAAGGAGAGCTGGAGGAGATGGAGCGGAAGCACCAGCAGCTTTTAGAAGAGAAGAATATCCTTGCAGAACAACTACAAGCAGAGACTGAGCTCTTTGCTGAAGCAGAAGAGATGAGGGCAAGACTTGCTGCTAAAAAGCAGGAATTAGAAGAGATTCTACATGACTTGGAGTCTAGGGTTGAAGAAGAAGAAGAAAGAAACCAAATCCTCCAAAATGAAAAGAAAAAAATGCAAGCACATATTCAGGACCTGGAAGAACAGCTAGACGAGGAGGAAGGGGCTCGGCAAAAGCTGCAGCTGGAAAAGGTGACAGCAGAGGCCAAGATCAAGAAGATGGAAGAGGAGATTCTGCTTCTCGAGGACCAAAATTCCAAGTTCATCAAAGAAAAGAAACTCATGGAAGATCGCATTGCTGAGTGTTCCTCTCAGCTGGCTGAAGAGGAAGAAAAGGCGAAAAACTTGGCCAAAATCAGGAATAAGCAAGAAGTGATGATCTCAGATTTAGAAGAACGCTTAAAGAAGGAAGAAAAGACTCGTCAGGAACTGGAAAAGGCCAAAAGAAAACTCGACGGGGAGACGACCGACCTGCAGGACCAGATCGCAGAGCTGCAGGCGCAGATTGATGAGCTCAAGCTGCAGCTGGCCAAGAAGGAGGAGGAGCTGCAGGGCGCACTGGCCAGAGGTGATGATGAAACACTCCATAAGAACAATGCCCTTAAAGTTGTGCGAGAGCTACAAGCCCAAATTGCTGAACTTCAGGAAGACTTTGAATCCGAGAAGGCTTCACGGAACAAGGCCGAAAAGCAGAAAAGGGACTTGAGTGAGGAACTGGAAGCTCTGAAAACAGAGCTGGAGGACACGCTGGACACCACGGCAGCCCAGCAGGAACTACGTACAAAACGTGAACAAGAAGTGGCAGAGCTGAAGAAAGCTCTTGAGGAGGAAACTAAGAACCATGAAGCTCAAATCCAGGACATGAGACAAAGACACGCAACAGCCCTGGAGGAGCTCTCAGAGCAGCTGGAACAGGCCAAGCGGTTCAAAGCAAATCTAGAGAAGAACAAGCAGGGCCTGGAGACAGATAACAAGGAGCTGGCGTGTGAGGTGAAGGTCCTGCAGCAGGTCAAGGCTGAGTCTGAGCACAAGAGGAAGAAGCTCGACGCGCAGGTCCAGGAGCTCCATGCCAAGGTCTCTGAAGGCGACAGGCTCAGGGTGGAGCTGGCGGAGAAAGCAAGTAAGCTGCAGAATGAGCTAGATAATGTCTCCACCCTTCTGGAAGAAGCAGAGAAGAAGGGTATTAAATTTGCTAAGGATGCAGCTAGTCTTGAGTCTCAACTACAGGATACACAGGAGCTTCTTCAGGAGGAGACACGCCAGAAACTAAACCTGAGCAGTCGGATCCGGCAGCTGGAAGAGGAGAAGAACAGTCTTCAGGAGCAGCAGGAGGAGGAGGAGGAGGCCAGGAAGAACCTGGAGAAGCAAGTGCTGGCCCTGCAGTCCCAGTTGGCTGATACCAAGAAGAAAGTAGATGACGACCTGGGAACAATTGAAAGTCTGGAAGAAGCCAAGAAGAAGCTTCTGAAGGACGCGGAGGCCCTGAGCCAGCGCCTGGAGGAGAAGGCACTGGCGTATGACAAACTGGAGAAGACCAAGAACCGCCTGCAGCAGGAGCTGGACGACCTCACGGTGGACCTGGACCACCAGCGCCAGGTCGCCTCCAACTTGGAGAAGAAGCAGAAGAAGTTTGACCAGCTGTTAGCAGAAGAGAAGAGCATCTCTGCTCGCTATGCCGAAGAGCGGGACCGGGCCGAAGCCGAGGCCAGAGAGAAAGAAACCAAAGCCCTGTCACTGGCCCGGGCCCTCGAGGAAGCCCTGGAGGCCAAGGAGGAGTTTGAGAGGCAGAACAAGCAGCTCCGAGCAGACATGGAAGACCTCATGAGCTCCAAAGATGATGTGGGAAAAAACGTTCACGAACTTGAAAAATCCAAACGGGCCCTAGAGCAGCAGGTGGAGGAAATGAGGACCCAGCTGGAGGAGCTGGAAGACGAACTCCAGGCCACGGAAGATGCCAAGCTTCGTCTGGAGGTCAACATGCAGGCCATGAAGGCGCAGTTCGAGAGAGACCTGCAAACCAGGGATGAGCAGAATGAAGAGAAGAAGCGGCTGCTGATCAAACAGGTGCGGGAGCTCGAGGCGGAGCTGGAGGATGAGAGGAAACAGCGGGCGCTTGCTGTAGCTTCAAAGAAAAAGATGGAGATAGACCTGAAGGACCTCGAAGCCCAAATCGAGGCTGCGAACAAAGCTCGGGATGAGGTGATTAAGCAGCTCCGCAAGCTCCAGGCTCAGATGAAGGATTACCAACGTGAATTAGAAGAAGCTCGTGCATCCAGAGATGAGATTTTTGCTCAATCCAAAGAGAGTGAAAAGAAATTGAAGAGTCTGGAAGCAGAAATCCTTCAATTGCAGGAGGAACTTGCCTCATCTGAGCGAGCCCGCCGACACGCCGAGCAGGAGAGAGATGAGCTGGCGGACGAGATCACCAACAGCGCCTCTGGCAAGTCCGCGCTGCTGGATGAGAAGCGGCGTCTGGAAGCTCGGATCGCACAGCTGGAGGAGGAGCTGGAAGAGGAGCAGAGCAACATGGAGCTGCTCAACGACCGCTTCCGCAAGACCACTCTACAGGTGGACACACTGAACGCCGAGCTAGCAGCCGAGCGCAGCGCCGCCCAGAAGAGTGACAATGCACGCCAGCAACTGGAGCGGCAGAACAAGGAGCTGAAGGCCAAGCTGCAGGAACTCGAGGGTGCTGTCAAGTCTAAGTTCAAGGCCACCATCTCAGCCCTGGAGGCCAAGATTGGGCAGCTGGAGGAGCAGCTTGAGCAGGAAGCCAAGGAACGAGCAGCCGCCAACAAATTAGTCCGTCGCACTGAGAAGAAGCTGAAAGAAATCTTCATGCAGGTTGAGGATGAGCGTCGACACGCGGACCAGTATAAAGAGCAGATGGAGAAGGCCAACGCTCGGATGAAGCAGCTTAAACGCCAGCTGGAGGAAGCAGAAGAAGAAGCGACGCGTGCCAACGCATCTCGGCGTAAACTCCAGCGGGAACTGGATGATGCCACCGAGGCCAACGAGGGCCTGAGCCGCGAGGTCAGCACCCTGAAGAACCGGCTGAGGCGGGGTGGCCCCATCAGCTTCTCTTCCAGCCGATCTGGCCGGCGCCAGCTGCACCTTGAAGGAGCTTCCCTGGAGCTCTCCGACGATGACACAGAAAGTAAGACCAGTGATGTCAACGAGACGCAGCCACCCCAGTCAGAGTAAAGTTGCAGGAAGCCAGAGGAGGCAATACAGTGGGACAGTTAGGAATGCACCCGGGGCCTCCTGCAGATTTCGGAAATTGGCAAGCTACGGGATTCCTTCCTGAAAGATCAACTGTGTCTTAAGGCTCTCCAGCCTATGCATACTGTATCCTGCTTCAGACTTAGGTACAATTGCTCCCCTTTTTATATATAGACACACACAGGACACATATATTAAACAGATTGTTTCATCATTGCATCTATTTTCCATATAGTCATCAAGAGACCATTTTATAAAACATGGTAAGACCCTTTTTAAAACAAACTCCAGGCCCTTGGTTGCGGGTCGCTGGGTTATTGGGGCAGCGCCGTGGTCGTCACTCAGTCGCTCTGCATGCTCTCTGTCATACAGACAGGTAACCTAGTTCTGTGTTCACGTGGCCCCCGACTCCTCAGCCACATCAAGTCTCCTAGACCACTGTGGACTCTAAACTGCACTTGTCTCTCTCATTTCCTTCAAATAATGATCAATGCTATTTCAGTGAGCAAACTGTGAAAGGGGCTTTGGAAAGAGTAGGAGGGGTGGGCTGGATCGGAAGCAACACCCATTTGGGGTTACCATGTCCATCCCCCAAGGGGGGCCCTGCCCCTCGAGTCGATGGTGTCCCGCATCTACTCATGTGAACTGGCCTTGGCGAGGGCTGGTCTGTGCATAGAAGGGATAGTGGCCACACTGCAGCTGAGGCCCCAGGTGGCAGCCATGGATCATGTAGACTTCCAGATGGTCTCCCGAACCGCCTGGCTCTGCCGGCGCCCTCCTCACGTCAGGAGCAAGCAGCCGTGGACCCCTAAGCCGAGCTGGTGGAAGGCCCCTCCCCATCGCCAGCCGGGCCCTCATGCTGACCTTGCAAATTCAGCCGCTGCTTTGAGCCCAAAATGGGAATATTGGTTTTGTGTCCGAGGCTTGTTCCAAGTTTGTCAATGAGGTTTATGGAGCCTCCAGAACAGATGCCATCTTCCTGAATGTTGACATGCCAGTGGGTGTGACTCCTTCATTTTTCCTTCTCCCTTCCCTTTGGACAGTGTTACAGTGAACACTTAGCATCCTGTTTTTGGTTGGTAGTTAAGCAAACTGACATTACGGAAAGTGCCTTAGACACTACAGTACTAAGACAATGTTGAATATATCATTCGCCTCTATAACAATTTAATGTATTCAGTTTTGACTGTGCTTCATATCATGTACCTCTCTAGTCAAAGTGGTATTACAGACATTCAGTGACAATGAATCAGTGTTAATTCTAAATCCTTGATCCTCTGCAATGTGCTTGAAAACACAAACCTTTTGGGTTAAAAGCTTTAACATCTATTAGGAAGAATTTGTCCTGTGGGTTTGGAATCTTGGATTTTCCCCCTTTATGAACTGTACTGGCTGTTGACCACCAGACACCTGACCGCAAATATCTTTTCTTGTATTCCCATATTTCTAGACAATGATTTTTGTAAGACAATAAATTTATTCATTATAGATATTTGCGCCTGCTCTGTTTACTTGAAGAAAAAAGCACCCGTGGAGAATAAAGAGACCTCAATAAACAAGAATAATCATGTGAACGTGG