Transcript asmbl_58455

Sequence
Transcript Sequence for observation asmbl_58455 of TGE0056256:
TCCCCTTCCCCCTAGCCCCAACTCTCCCCAACTCCAACCCTGACCCAGAAAGTAGAGTGATTTGGAGGCTGGAAGACAAAACCATGTAAGGTCTGTGGAAATCACAGCTGTTCAGACCCGCCTCCAACCCCGGCCACCCCGCCCCCTTGCCCTAGCCTTCCTGTGTCCTTCCCACCCTTAGTCCCAGGCATCTGACTACCGGGAACCTCAGCCAGAGTCCGGGAGCCCCCCACCCCGTCCAGGAGCCAACAGAGCCCCCGTCTTGCTGGCGTGAGAATACATTGCTCTCCTTTGGTTGAATCAGCTGTCCCTCTTCGTGGGAAAATGAACCAGAAGACAATCCTCGTGCTCCTCATTCTGGCCGTCATCACCATCTTTGCCTTGGTTTGTGTCCTGCTGGTGGGCAGGGGTGGAGATGGGGGTGAACCCAGCCAGCTTCCCCATTGCCCCTCTGTATCTCCCAGTGCCCAGCCTTGGACACACCCTGGCCAGAGCCAGCTGTTTGCAGACCTGAGCCGAGAGGAGCTGACGGCTGTGATGCGCTTTCTGACCCAGCGGCTGGGGCCAGGGCTGGTGGATGCAGCCCAGGCCCGGCCCTCGGACAACTGTGTCTTCTCAGTGGAGTTGCAGCTGCCTCCCAAGGCTGCAGCCCTGGCTCACTTGGACAGGGGGAGCCCCCCACCTGCCCGGGAGGCACTGGCCATCGTCTTCTTTGGCAGGCAACCCCAGCCCAACGTGAGTGAGCTGGTGGTGGGGCCACTGCCTCACCCCTCCTACATGCGGGACGTGACTGTGGAGCGTCATGGAGGCCCCCTGCCCTATCACCGACGCCCCGTGCTGTTCCAAGAGTACCTGGACATAGACCAGATGATCTTCAACAGAGAGCTGCCCCAGGCTTCTGGGCTTCTCCACCACTGTTGCTTCTACAAGCACCGGGGACGGAACCTGGTGACAATGACCACGGCTCCCCGTGGTCTGCAATCAGGGGACCGGGCCACCTGGTTTGGCCTCTACTACAACATCTCGGGCGCTGGGTTCTTCCTGCACCACGTGGGCTTGGAGCTGCTAGTGAACCACAAGGCCCTTGACCCTGCCCGCTGGACTATCCAGAAGGTGTTCTATCAAGGCCGCTACTACGACAGCCTGGCCCAGCTGGAGGCCCAGTTTGAGGCCGGCCTGGTGAATGTGGTGCTGATCCCAGACAATGGCACAGGTGGGTCCTGGTCCCTGAAGTCCCCTGTGCCCCCGGGTCCAGCTCCCCCTCTACAGTTCTATCCCCAAGGCCCCCGCTTCAGTGTCCAGGGAAGTCGAGTGGCCTCCTCACTGTGGACTTTCTCCTTTGGCCTCGGAGCATTCAGTGGCCCAAGGATCTTTGACGTTCGCTTCCAAGGAGAAAGACTAGTTTATGAGATAAGCCTCCAAGAGGCCTTGGCCATCTATGGTGGAAATTCCCCAGCAGCAATGACGACCCGCTATGTGGATGGAGGCTTTGGCATGGGCAAGTACACCACGCCCCTGACCCGTGGGGTGGACTGCCCCTACTTGGCCACCTACGTGGACTGGCACTTCCTTTTGGAGTCCCAGGCCCCCAAGACAATACGTGATGCCTTTTGTGTGTTTGAACAGAACCAGGGCCTCCCCCTGCGGCGACACCACTCAGATCTCTACTCGCACTACTTTGGGGGTCTTGCGGAAACGGTGCTGGTCGTCAGATCTATGTCCACCTTGCTCAACTATGACTATGTGTGGGATACGGTCTTCCACCCCAGTGGGGCCATAGAAATACGATTCTATGCCACGGGCTACATCAGCTCGGCATTCCTCTTTGGTGCTACTGGGAAGTACGGGAACCAAGTGTCAGAGCACACCCTGGGCACGGTCCACACCCACAGCGCCCACTTCAAGGTGGATCTGGATGTAGCAGGACTGGAGAACTGGGTCTGGGCCGAGGATATGGTCTTTGTCCCCATGGCTGTGCCCTGGAGCCCTGAGCACCAGCTGCAGAGGCTGCAGGTGACCCGGAAGCTGCTGGAGATGGAGGAGCAGGCCGCCTTCCTCGTGGGAAGCGCCACCCCTCGCTACCTGTACCTGGCCAGCAACCACAGCAACAAGTGGGGTCACCCCCGGGGCTACCGCATCCAGATGCTCAGCTTTGCTGGAGAGCCGCTGCCCCAAAACAGCTCCATGGCGAGAGGCTTCAGCTGGGAGAGGTACCAGCTGGCTGTGACCCAGCGGAAGGAGGAGGAGCCCAGTAGCAGCAGCGTTTTCAATCAGAATGACCCTTGGGCCCCCACTGTGGATTTCAGTGACTTCATCAACAATGAGACCATTGCTGGAAAGGATTTGGTGGCCTGGGTGACAGCTGGTTTTCTGCATATCCCACATGCAGAGGACATTCCTAACACAGTGACTGTGGGGAACGGCGTGGGCTTCTTCCTCCGACCCTATAACTTCTTTGACGAAGACCCCTCCTTCTACTCTGCCGACTCCATCTACTTCCGAGGGGACCAGGATGCTGGGGCCTGCGAGGTCAACCCCCTAGCTTGCCTGCCCCAGGCTGCTGCCTGTGCCCCCGACCTCCCTGCCTTCTCCCACGGGGGCTTCTCTCACAACTAGGCGGTCCTGGGATGGGGCATGTGGCCAAGGGCTCCAGGGCCAGGGTGTGAGGGATGGGGAGCAGCTGGGCACTGGGCCGGCAGCCTGGTTCCCTCTTTCCTGTGCCAGGACTCTCTTTCTTCCACTACCCTCCCTCGCATCCGCCTCTGAGCCAGGAGCCTCCTGACCCTGTGATGCCTGACACAGGGGACACTGAACCTTGTTGATGCCAGCTGTACTGAGTTCTCATCCACAGAGGCCAGGCATGGCCCAGCCTGGAGCCGTGGCCGAGGGCTTCCCTAGATGGTTCCCTTTGTTGCTGTCTGGCTTTCCCGAATCTTTTTAGGCCACCTCCAAGGACTCTAAAAGGGGGCTATTCCCTGGAGACCCCAGAGTAGGGTTGCCAGTCCTGCAAGTCCATAGCTGAGCTGGAAAGGATGCTTCTGCTCACATTCCCTCTCATCCAGGTCCTTTCCTTCTCGTCTTCCTCTCTCTCACCTACTTCCTCCTCCTCCTCCTGTTCCTGCCTTCTCTTCTATCCTGCAATTTCTCCCGAATCCTGAGGGGATATCCCTATGTCCCAGCCCCTGGTACTCCCCCAGCCCTCAGTTTTCAGTCAAGTTCCGTCTCCTCTCCAGCCCTATGGAAGTCTCAAGGTCACGGGACCCCTAATCAGAGTGGCCAATCCCTGTGTGTCGTTCCCTTGTGTCTGTTGCTTATTGGGAGTAGGAGTTGCTCCTACCCCTGTCCTGGGGCTGGGTGTGTTTCAGGACAGCTGCTTCTGTGCATTTGTGTCTGCCTGCCTCATGCTCTCTATAGAGGAGGATGGTCATCGTGACAGCAGCAGCTCAAGTTAGCATTTCAAGTGATTTGGGGGTGCAATGATAATGAAGAATGGCCATTTTGTACCAGGGCTCTGTATTCTGCAACAGCCTGTTTGGGAGGCTGGAGTGGAAACAAAGGGTGGGCATCAAAGATGAGAAGCCAAAGCCCCTACAACTCCAGCCACCCAGCCAGGAGGGGCTGTCCAATCACATTCAGGCATGCGAATGAGCTGGGCCCTGGGTGAGGTGGGGGTCTGGCCTAGTGGGGAGGGGCCTGGCCTGGGTGGGGCAGGGCCTGGCCTGGTCCAGGCTTGGGCTCCATTCCCATCACTGCTGTCCCTCCTGAGGTCTGGATTGGGGATGGGGACAAAGAAATAGCAAGAGATGAGAAACAACAGAAACTTTTTTCTCTAAAGGACTGGTTAAATCAATTCTGATACAGCCTTACAATACAATAGTATGCAGCTAAAAAATAATTGTATGTCTTTATATACTAATATGTAATAATCTTCAGGTGAAAAAGGCAAGCCACAGAAATGTGTATAGCGCACTTCCCATTTGTGTTTCAGAAAGGAGTAGAATATAAACACATAATTGCTTATGTATGCCTATTCAGAATAAATGGGTAACACTGATTACTTTTGGGAGGGGAACCAGTAGGTTGAGGACAGGAGAGGGAAGGGTCTTAACACTTACACCCTTTTGTACATTTTGAATTTTGAACCATGTGACTGTATTACCTATTCAAAATAAACAATAAATGGGCCCAAACAGGAA