Transcript asmbl_58454

Sequence
Transcript Sequence for observation asmbl_58454 of TGE0056558:
TCCCCTTCCCCCTAGCCCCAACTCTCCCCAACTCCAACCCTGACCCAGAAAGTAGAGTGATTTGGAGGCTGGAAGACAAAACCATGTAAGGTCTGTGGAAATCACAGCTGTTCAGACCCGCCTCCAACCCCGGCCACCCCGCCCCCTTGCCCTAGCCTTCCTGTGTCCTTCCCACCCTTAGTCCCAGGCATCTGACTACCGGGAACCTCAGCCAGAGTCCGGGAGCCCCCCACCCCGTCCAGGAGCCAACAGAGCCCCCGTCTTGCTGGCGTGAGAATACATTGCTCTCCTTTGGTTGAATCAGCTGTCCCTCTTCGTGGGAAAATGAACCAGAAGACAATCCTCGTGCTCCTCATTCTGGCCGTCATCACCATCTTTGCCTTGGTTTGTGTCCTGCTGGTGGGCAGGGGTGGAGATGGGGGTGAACCCAGCCAGCTTCCCCATTGCCCCTCTGTATCTCCCAGTGCCCAGCCTTGGACACACCCTGGCCAGAGCCAGCTGTTTGCAGACCTGAGCCGAGAGGAGCTGACGGCTGTGATGCGCTTTCTGACCCAGCGGCTGGGGCCAGGGCTGGTGGATGCAGCCCAGGCCCGGCCCTCGGACAACTGTGTCTTCTCAGTGGAGTTGCAGCTGCCTCCCAAGGCTGCAGCCCTGGCTCACTTGGACAGGGGGAGCCCCCCACCTGCCCGGGAGGCACTGGCCATCGTCTTCTTTGGCAGGCAACCCCAGCCCAACGTGAGTGAGCTGGTGGTGGGGCCACTGCCTCACCCCTCCTACATGCGGGACGTGACTGTGGAGCGTCATGGAGGCCCCCTGCCCTATCACCGACGCCCCGTGCTGTTCCAAGAGTACCTGGACATAGACCAGATGATCTTCAACAGAGAGCTGCCCCAGGCTTCTGGGCTTCTCCACCACTGTTGCTTCTACAAGCACCGGGGACGGAACCTGGTGACAATGACCACGGCTCCCCGTGGTCTGCAATCAGGGGACCGGGCCACCTGGTTTGGCCTCTACTACAACATCTCGGGCGCTGGGTTCTTCCTGCACCACGTGGGCTTGGAGCTGCTAGTGAACCACAAGGCCCTTGACCCTGCCCGCTGGACTATCCAGAAGGTGTTCTATCAAGGCCGCTACTACGACAGCCTGGCCCAGCTGGAGGCCCAGTTTGAGGCCGGCCTGGTGAATGTGGTGCTGATCCCAGACAATGGCACAGGTGGGTCCTGGTCCCTGAAGTCCCCTGTGCCCCCGGGTCCAGCTCCCCCTCTACAGTTCTATCCCCAAGGCCCCCGCTTCAGTGTCCAGGGAAGTCGAGTGGCCTCCTCACTGTGGACTTTCTCCTTTGGCCTCGGAGCATTCAGTGGCCCAAGGATCTTTGACGTTCGCTTCCAAGGAGAAAGACTAGTTTATGAGATAAGCCTCCAAGAGGCCTTGGCCATCTATGGTGGAAATTCCCCAGCAGCAATGACGACCCGCTATGTGGATGGAGGCTTTGGCATGGGCAAGTACACCACGCCCCTGACCCGTGGGGTGGACTGCCCCTACTTGGCCACCTACGTGGACTGGCACTTCCTTTTGGAGTCCCAGGCCCCCAAGACAATACGTGATGCCTTTTGTGTGTTTGAACAGAACCAGGGCCTCCCCCTGCGGCGACACCACTCAGATCTCTACTCGCACTACTTTGGGGGTCTTGCGGAAACGGTGCTGGTCGTCAGATCTATGTCCACCTTGCTCAACTATGACTATGTGTGGGATACGGTCTTCCACCCCAGTGGGGCCATAGAAATACGATTCTATGCCACGGGCTACATCAGCTCGGCATTCCTCTTTGGTGCTACTGGGAAGTACGGGAACCAAGTGTCAGAGCACACCCTGGGCACGGTCCACACCCACAGCGCCCACTTCAAGGTGGATCTGGATGTAGCAGGACTGGAGAACTGGGTCTGGGCCGAGGATATGGTCTTTGTCCCCATGGCTGTGCCCTGGAGCCCTGAGCACCAGCTGCAGAGGCTGCAGGTGACCCGGAAGCTGCTGGAGATGGAGGAGCAGGCCGCCTTCCTCGTGGGAAGCGCCACCCCTCGCTACCTGTACCTGGCCAGCAACCACAGCAACAAGTGGGGTCACCCCCGGGGCTACCGCATCCAGATGCTCAGCTTTGCTGGAGAGCCGCTGCCCCAAAACAGCTCCATGGCGAGAGGCTTCAGCTGGGAGAGGTACCAGCTGGCTGTGACCCAGCGGAAGGAGGAGGAGCCCAGTAGCAGCAGCGTTTTCAATCAGAATGACCCTTGGGCCCCCACTGTGGATTTCAGTGACTTCATCAACAATGAGACCATTGCTGGAAAGGTCAGCTGGCCGGGGTAGAGGGTACAGGATGAGCCTTGCTTTCTCTTGGGAGGGTCCCTGAAAACCACCTGCACTTCTCAGGGGTGGTGCTGATTCCTGCCTTCTGCACTTCAGTATATCTGATCATTATCCTTTGAGGGAACCTTCCTGAGCTGGGTGTCCATATGCAGACACTGAGTGAGGCCCTGGGCCTGTCCTTGAGATCTTAGAGCCCTCTTAGTTCCAGTTTCATGGACTGAGTCCTTTCCAGGCTCCAGGACTCAGGAGGGATGGAAGTTACCAGGGAAAATGACATCTCCTGTATCTGAAGCTTCTCCCATTCCTGACTTG