Transcript asmbl_52670

Sequence
Transcript Sequence for observation asmbl_52670 of TGE0057037:
TAGACACTGGCGGCTAGAGGGGCCCGGACTTGCCCTCCCAGCTCTAACTTCCGCCGGAAGTGCCTTCCAGCCGCAGGCGCCCTTCTTCTTCTGTGCGCTCGGGCTCCTGGTCCCGGCTCCCCGGTTACCGGGGCGCGAGTATGACCACAATGGCGGCCGCCACCCTGCTGCGCGCGACGCCCCACTTCAGCGGTCTCGCCGCCGGCCGGACCTTCCTGCTGCAGGGTCTGTTGCGGCTGCTGAAAGCCCCGGCATTGCCTCTCTTGTGCCGCGGCCTGGCCGTGGAGGCCAAGAAGACTTACGTGCGCGACAAGCCACATGTGAATGTGGGTACCATCGGCCATGTGGACCACGGGAAGACCACGCTGACTGCAGCCATCACGAAGATTCTAGCTGAGGGAGGTGGGGCTAAGTTCAAGAAGTACGAGGAGATTGACAATGCCCCGGAGGAGCGAGCTCGGGGTATCACCATCAATGCGGCTCATGTGGAGTATAGCACTGCCGCCCGCCACTACGCCCACACAGACTGCCCGGGTCATGCAGATTATGTTAAGAATATGATCACAGGCACTGCACCCCTCGACGGCTGCATCCTGGTGGTAGCAGCCAATGACGGCCCCATGCCCCAGACCCGAGAGCACTTATTACTGGCCAGACAGATTGGGGTGGAGCATGTGGTGGTGTATGTGAACAAGGCTGACGCTGTCCAGGACTCTGAGATGGTGGAACTGGTGGAACTGGAGATCCGGGAGCTGCTCACCGAGTTTGGCTATAAAGGGGAGGAGACCCCAGTCATCGTAGGCTCTGCTCTCTGTGCCCTTGAGGGTCGGGACCCTGAGTTAGGCCTGAAGTCTGTGCAGAAGCTACTGGATGCTGTGGACACTTACATCCCAGTGCCCGCCCGGGACCTGGAGAAGCCTTTCCTGCTGCCTGTGGAGGCGGTGTACTCCGTCCCTGGCCGTGGCACCGTGGTGACAGGTACACTAGAGCGTGGCATTTTAAAGAAGGGAGACGAGTGTGAGCTCCTAGGACATAGCAAGAACATCCGCACTGTGGTGACAGGCATTGAGATGTTCCACAAGAGCCTGGAGAGGGCCGAGGCCGGAGATAACCTCGGGGCCCTGGTCCGAGGCTTGAAGCGGGAGGACTTGCGGCGGGGCCTGGTCATGGTCAAGCCAGGTTCCATCAAGCCCCACCAGAAGGTGGAGGCCCAGGTTTACATCCTCAGCAAGGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCACTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGGATTATCCTGCCCCCAGAGAAGGAGCTTGCCATGCCCGGGGAGGACCTGAAGTTCAACCTAATCTTGCGGCAGCCAATGATCTTAGAGAAAGGCCAGCGTTTCACCCTGCGAGATGGCAACCGGACTATTGGCACCGGTCTAGTCACCAACACGCTGGCCATGACTGAGGAGGAGAAGAATATCAAATGGGGTTGAGTGTGCAGATCTCTGCTCAGCTTCCCTTGCGTTTAAGGCCTGCCCTAGCCAGGGCTCCCTCCTGCTTCCAGTACCCTCTCATGGCATAGGCTGCAACCCAGCAGAGGGCAGCTAGATGGACATTTCCCCTGCTCGGAAGGGTTGGCCTGCCTGGCTGGGGAGGTCAGTAAACTTTGAATAGTAAGCCA