Transcript asmbl_5108

Sequence
Transcript Sequence for observation asmbl_5108 of TGE0031172:
CCCAGGTAAGTGAAAAAGCCGCTTTCGGTCAACGACTTAAGTCTTTACGGCTGTGAGCGCTATGGGCCGCGGTAGCTTTCCGTTAACTTCAGATCCGATTGTCGCCCCACTGCCAAAGTTACCTTCCAACATCGTTACTGTTGCACTTTACGCAGTCAAGTGTCCAACTCCTCAGATGAGCAAGTGGTCGGCCCTAAAAAGGGCCTTTGGGATCGAAACGTGCAAAGCTGGAGCGGCGGCCTAGCCTCCGAAGCCGTACAGGGTGCGCCCCTGGCGCTTGAGCGCGTACACCACATCCATGGCTGTGACGGTCTTGCGCTTGGCGTGCTCGGTGTAGGTGACTGCGTCCCGAATCACATTCTCCAGGAACACCTTCAGCACACCGCGGGTCTCCTCGTAAATGAGGCCAGAGATCCGCTTAACGCCGCCACGCCGAGCTAGACGCCGAATGGCAGGCTTGGTGATGCCCTGAATGTTGTCTCTCAAGACCTTGCGGTGGCGCTTAGCGCCCCCTTTGCCTAAGCCTTTTCCGCCCTTTCCTCTGCCGGACATGACCGCTGGAGCCCGATAGACAGCTTCTGTCAAGGCGAGCACCGTCTTCCCCTGATATACAAGAGTATCGGACCAGATTGAAAACCGAAAGCGCGCCGGCGGGAAGCGTTCTCAATTGTCCCCGCCCTCTCGACATTTCGTCATTTCTTTTCTGTTTTCCTCTCCC