Transcript asmbl_5094

Sequence
Transcript Sequence for observation asmbl_5094 of TGE0031172:
CCCAGGTAAGTGAAAAAGCCGCTTTCGGTCAACGACTTAAGTCTTTACGGCTGTGAGCGCTATGGGCCGCGGTAGCTTTCCGTTAACTTCAGATCCGATTGTCGCCCCACTGCCAAAGTTACCTTCCAACATCGTTACTGTTGCACTTTACGCAGTCAAGTGTCCAACTCCTCAGATGAGCAAGTGGTCGGCCCTAAAAAGGGCCTTTGGGATCGAAACGTGCAAAGCTGGAGCGGCGGCCTAGCCTCCGAAGCCGTACAGGGTGCGCCCCTGGCGCTTGAGCGCGTACACCACATCCATGGCTGTGACGGTCTTGCGCTTGGCGTGCTCGGTGTAGGTGACTGCGTCCCGAATCACATTCTCCAGGAACACCTTCAGCACACCGCGGGTCTCCTCGTAAATGAGGCCAGAGATCCGCTTAACGCCGCCACGCCGAGCTAGACGCCGAATGGCAGGCTTGGTGATGCCCTGAATGTTGTCTCTCAAGACCTTGCGGTGGCGCTTAGCGCCCCCTTTGCCTAAGCCTTTTCCGCCCTTTCCTCTGCCGGACATGACCGCTGGAGCCCGATAGACAGCTTCTGTCAAGGCGAGCACCGTCTTCCCCTGATATACAAGAGTATCGGACCAGATTGAAAACCGAAAGCGCGCCGGCGGGAAGCGTTCTCAATTGTCCCCGCCCTCTCGACATTTCGTCATTTCTTTTCTGTTTTCCTCTCCC