Transcript asmbl_48987

Sequence
Transcript Sequence for observation asmbl_48987 of TGE0000626:
CTTTTCCGCTCCACGGTGACCTCCGTGCGGCCGGGTGCGGGCGGAGTCTTCCTCGATCCCGTGGTGCTCCGCGGCGCGGCCTTGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGGTATTTAGCCTAGTTGGCAAGCGAGCAATTTCCACCTCTGTGTGTGTACGAGCTCATGAAAGTGTTGTGAAGAGCGAAGACTTTTCGCTCCCAGCTTATATGGATCGGCGTGACCACCCCTTGCCGGAGGTGGCCCATGTCAAGCACCTGTCTGCCAGCCAGAAGGCATTGAAGGAGAAGGAGAAGGCCTCCTGGAGCAGCCTCTCCATGGATGAGAAAGTCGAGTTGTATCGCATTAAGTTCAAGGAGAGCTTTGCTGAGATGAACAGGGGCTCGAACGAGTGGAAGACGGTTGTGGGCGGTGCCATGTTCTTCATCGGTTTCACCGCGCTCGTTATCATGTGGCAGAAGCACTATGTGTACGGCCCCCTCCCGCAAAGCTTTGACAAAGAGTGGGTGGCCAAGCAGACCAAGAGGATGCTGGACATGAAGGTGAACCCCATCCAGGGCTTAGCCTCCAAGTGGGACTACGAAAAGAACGAGTGGAAGAAGTGAGAGATGCTGGCCTGCGCCTGCACCTGCGCCTGGCTCTGTCACCGCCATGCAACTCCATGCCTATTTACTGGAAACCTGTTATGCCAAACAGTTGTACCACTGCTAATAAATGACCAGTTTACCTG