Transcript asmbl_48917

Sequence
Transcript Sequence for observation asmbl_48917 of TGE0057036:
GGCAAGACCAACCAAGATGAGTGCCCTGGGAGCTGTCATTGCCCTCCTGCTCTGGGGACAGCTTTTTGCAGTGGACTCAGGCAATGATGTCACGGATATCGCAGATGACGGCTGCCCGAAGCCCCCCGAGATTGCACATGGCTATGTGGAGCACTCGGTTCGCTACCAGTGTAAGAACTACTACAAACTGCGCACAGAAGGAGATGGAGTGTACACCTTAAACAATGAGAAGCAGTGGATAAATAAGGCTGTTGGAGATAAACTTCCTGAATGTGAAGCAGTATGTGGGAAGCCCAAGAATCCGGCAAACCCAGTGCAGCGGATCCTGGGTGGACACCTGGATGCCAAAGGCAGCTTTCCCTGGCAGGCTAAGATGGTTTCCCACCATAATCTCACCACAGGTGCCACGCTGATCAATGAACAATGGCTGCTGACCACGGCTAAAAATCTCTTCCTGAACCATTCAGAAAATGCAACAGCGAAAGACATTGCCCCTACTTTAACACTCTATGTGGGGAAAAAGCAGCTTGTAGAGATTGAGAAGGTTGTTCTACACCCTAACTACTCCCAGGTAGATATTGGGCTCATCAAACTCAAACAGAAGGTGTCTGTTAATGAGAGAGTGATGCCCATCTGCCTACCTTCAAAGGATTATGCAGAAGTAGGGCGTGTGGGTTATGTTTCTGGCTGGGGGCGAAATGCCAATTTTAAATTTACTGACCATCTGAAGTATGTCATGCTGCCTGTGGCTGACCAAGACCAATGCATAAGGCATTATGAAGGCAGCACAGTCCCCGAAAAGAAGACACCGAAGAGCCCTGTAGGGGTGCAGCCCATACTGAATGAACACACCTTCTGTGCTGGCATGTCTAAGTACCAAGAAGACACCTGCTATGGCGATGCGGGCAGTGCCTTTGCCGTTCACGACCTGGAGGAGGACACCTGGTATGCGACTGGGATCTTAAGCTTTGATAAGAGCTGTGCTGTGGCTGAGTATGGTGTGTATGTGAAGGTGACTTCCATCCAGGACTGGGTTCAGAAGACCATAGCTGAGAACTAATGCAAGGCTGGCCGGAAGCCCTTGCCTGAAAGCAAGATTTCAGCCTGGAAGAGGGCAAAGTGGACGGGAGTGGACAGGAGTGGATGCGATAAGATGTGGTTTGAAGCTGATGGGTGCCAGCCCTGCATTGCTGAGTCAATCAATAAAGAGCTTTCTTTTGACC