Transcript asmbl_48478

Sequence
Transcript Sequence for observation asmbl_48478 of TGE0000592:
TCCTGCGCCGCCCCTTCCGAGGCTAAATCGGCTGCGTTCCTCTCGGAACGCGCCGCAGAAGGGGTCCTGGTGACGAGTCCCGCGTTCTCTCCTTGAATCCACTCGCCAGCCCGCCGCCCTCTGCCGCCGCACCCTGCACACCCGCCCCTCTCCTGTGCCAGGAACTTGCTACTACCAGCACCATGCCCTACCAATATCCAGCACTGACCCCGGAGCAGAAGAAGGAGCTGTCTGACATCGCTCACCGCATCGTGGCACCTGGCAAGGGCATCCTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACCGAGAACACCGAGGAGAACCGGCGCTTCTACCGCCAGCTGCTGCTGACAGCTGACGACCGCGTGAACCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACACTCTACCAGAAGGCGGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGCGTGGTCCCCCTGGCAGGGACAAATGGCGAGACTACCACCCAAGGGTTGGATGGGCTGTCTGAGCGCTGTGCCCAGTACAAGAAGGACGGAGCTGACTTCGCCAAGTGGCGTTGTGTGCTGAAGATTGGGGAACACACCCCCTCAGCCCTCGCCATCATGGAAAATGCCAATGTTCTGGCCCGTTATGCCAGTATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCATGACTTGAAGCGCTGCCAGTATGTGACCGAGAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCACCACATCTACCTGGAAGGCACCTTGCTGAAGCCCAACATGGTCACCCCAGGCCATGCTTGCACTCAGAAGTTTTCTCATGAGGAGATTGCCATGGCGACCGTCACAGCGCTGCGCCGCACAGTGCCCCCCGCTGTCACTGGGATCACCTTCCTGTCTGGAGGCCAGAGTGAGGAGGAGGCGTCCATCAACCTCAATGCCATTAACAAGTGCCCCCTGCTGAAGCCCTGGGCCCTGACCTTCTCCTACGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGCGGGAAGAAGGAGAACCTGAAGGCTGCGCAGGAGGAGTATGTCAAGCGAGCCCTGGCCAACAGCCTTGCCTGTCAAGGAAAGTACACTCCGAGCGGTCAGGCTGGGGCTGCTGCCAGCGAGTCCCTCTTCGTCTCTAACCACGCCTATTAAGCGGAGGTGTTCCCAGGCTGCCCCCAACACTCCAGGCCCTGCCCCCTCCCACTCTTGAAGAGGAGGCCGCCTCCTCGGGGCTCCAGGCTGGCTTGCCCGCGCTCTTTCTTCCCTCGTGACAGTGGTGTGTGGTGTCGTCTGTGAATGCTAAGTCCATCACCCTTTCCGGCACACTGCCAAATAAACAGCTATTTAAGGGGGAGTCGGCCGTCCGTGTCTTGTGGTGTCTAATGCAGGGGAGGGCCTGGGGAGGTAGCAGAGCCCAGAAGAAGAAAGAGCCCCTGTTCTCTGTTTTTT