Transcript asmbl_48476

Sequence
Transcript Sequence for observation asmbl_48476 of TGE0057035:
GAGGGGCTAGTGCTCGGGCAGGTGCCCTGGCTTCCCTTCCCCTCCACACGTCAACGATTCTATTTGAAGTTGGGCAGGGGGGTGGCGCTGCTCACCACACACAAGTGTTATAGGAGGAGTCTGGCCCTTGAGTACCGGGTACGCAGGGGTGCCTCAACCACACTCCGTCCACGGACTCTCCGTTATTTTAGGAGGTCCCTGGCCAAAGATTTATTTCTCTTGACAACCAAGGGCCTCCGTCTGGATTTCCAAGGAAGAATTTCCTCTGAAGCACCGGAACTTGCTACTACCAGCACCATGCCCTACCAATATCCAGCACTGACCCCGGAGCAGAAGAAGGAGCTGTCTGACATCGCTCACCGCATCGTGGCACCTGGCAAGGGCATCCTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACCGAGAACACCGAGGAGAACCGGCGCTTCTACCGCCAGCTGCTGCTGACAGCTGACGACCGCGTGAACCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACACTCTACCAGAAGGCGGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGCGTGGTCCCCCTGGCAGGGACAAATGGCGAGACTACCACCCAAGGGTTGGATGGGCTGTCTGAGCGCTGTGCCCAGTACAAGAAGGACGGAGCTGACTTCGCCAAGTGGCGTTGTGTGCTGAAGATTGGGGAACACACCCCCTCAGCCCTCGCCATCATGGAAAATGCCAATGTTCTGGCCCGTTATGCCAGTATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCATGACTTGAAGCGCTGCCAGTATGTGACCGAGAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCACCACATCTACCTGGAAGGCACCTTGCTGAAGCCCAACATGGTCACCCCAGGCCATGCTTGCACTCAGAAGTTTTCTCATGAGGAGATTGCCATGGCGACCGTCACAGCGCTGCGCCGCACAGTGCCCCCCGCTGTCACTGGGATCACCTTCCTGTCTGGAGGCCAGAGTGAGGAGGAGGCGTCCATCAACCTCAATGCCATTAACAAGTGCCCCCTGCTGAAGCCCTGGGCCCTGACCTTCTCCTACGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGCGGGAAGAAGGAGAACCTGAAGGCTGCGCAGGAGGAGTATGTCAAGCGAGCCCTGGCCAACAGCCTTGCCTGTCAAGGAAAGTACACTCCGAGCGGTCAGGCTGGGGCTGCTGCCAGCGAGTCCCTCTTCGTCTCTAACCACGCCTATTAAGCGGAGGTGTTCCCAGGCTGCCCCCAACACTCCAGGCCCTGCCCCCTCCCACTCTTGAAGAGGAGGCCGCCTCCTCGGGGCTCCAGGCTGGCTTGCCCGCGCTCTTTCTTCCCTCGTGACAGTGGTGTGTGGTGTCGTCTGTGAATGCTAAGTCCATCACCCTTTCCGGCACACTGCCAAATAAACAGCTATTTAAGGGGGAGTCGGCCGTCCGTGTCTTGTGGTGTCTAATGCAGGGGAGGGCCTGGGGAGGTAGCAGAGCCCAGAAGAAGAAAGAGCCCCTGTTCTCTGTTTTTT