Transcript asmbl_47310

Sequence
Transcript Sequence for observation asmbl_47310 of TGE0057032:
GGAGAAAAAAGCTTTTCCAAAAAAGTATTGGCTGTCTTGAGGAATGCGGTCGCCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAGGGCCCCTCGCCGCCGCCACCATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTCGACAAGGAGAACGCCTTGGATCGAGCTGAGCAGGCGGAGGCCGACAAGAAGGCGGCGGAAGACAGGAGCAAGCAGCTGGAAGATGAGCTGGTGTCACTGCAAAAGAAACTCAAGGGCACCGAAGATGAACTGGACAAATACTCTGAGGCTCTCAAAGATGCCCAGGAGAAGCTGGAGCTGGCAGAGAAAAAGGCCACCGATGCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAAGCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAAGAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATTGCTGAAGATGCCGACCGCAAATATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAGCTCTCAGAAGGCCAAGTCCGACAGCTGGAAGAACAATTAAGAATAATGGATCAGACCTTGAAAGCATTAATGGCTGCAGAGGATAAGGTACTGATGGCTCGTGTGGTTTTTAGGTTTAACTGCAACCCAGACATCTTTCAGCTTCCAATGCCTCCTGGTTCGTTTGGTATAACGACTGCACCTTCACTTCACCCTCTGCTATTTATATCTTGCCTTAAGTGCTTTCCCTTGGTCCTTTATGCTCCTTTGTTTTCCCTTCATAAATGCTCTTTGGGCAGCCAAAAAAGGAGCCAAATTATCGCACTTCAAAGTTGTTGGATTTGGTCACCCTGCCTTCTGCTGTTGCGAGGTTGGGGGGCAGTGTTCCTGGAAAACCTAAACATTTTAATACCTGATGATTTGGCTACTTTAAGGCAGCCCTTCGTCTCTAGGACTCAGTTTTCATTTTTTCCCATCCCTCTCCTTTTTCTCTCCTCCTTCCTTTGGCTTGTCTCCCACCCTTTCTGCCTCTGATCGAAAACATTAGCAAATGTGCCGAGCTTGAAGAAGAATTGAAAACTGTGACGAACAACTTGAAGTCACTGGAGGCTCAGGCTGAGAAGTACTCGCAGAAGGAAGACAGATATGAGGAAGAGATCAAGGTCCTTTCCGACAAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTTGCGGAGAGGTCAGTAACTAAATTGGAGAAAAGCATTGATGACTTAGAAGATAAGTTTCTTTGCTTCACTTCTCCCAAGACTCCCTCGTCGAGCTGGATGTCCCACCTCTCTGAGCTCTGCATTTGTCTATTCTCCAGCTGACCCTGGTTCTCTCTCTTAGCATCCTGCCTTAGAGCCAGGCACACACTGTGCTTTCTATTGTACAGAAGCTCTTCGTTTCAGTGTCAAATAAACACTGTGTAAGCTATTTCTGTTTGCTATTCTTTTTACTTCTTATTTATTGACATTTTAGTTTCAACATTGAATAAAACTACAAAGCTGCTTCACACATATGAGGGTTAGTGTTTGGCTGCTGCTTTTTCTTTTTAAATACTGAACACTATACAGAATTATATCAGGAGTTTCTAAAGCAGTAGTTCCTTGTTGAACTTCAAAAAAATACCCAGGCCTGCATTCCCTCTCAGAGTTCTGATTTTCAAAG