Transcript asmbl_47186

Sequence
Transcript Sequence for observation asmbl_47186 of TGE0057031:
CCCAAGCCGGGTTTGGGGGTTGGGACCTCCGGCTGCAGGTCCGCCTGGGCCAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGCCGAGCCGCGACCCTTCCGGCCGTCCCCACCCCACCTCGCCGCCATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGCCTCGCCGCTGCCTCCGACGTGCTAGAACTCACGGACGACAACTTCGAGAGTCGCATCTCCGACACGGGCTCTGCGGGCCTCATGCTCGTCGAGTTCTTCGCCCCCTGGTGTGGACACTGCAAGAGACTTGCACCTGAGTATGAAGCTGCAGCTACCAGATTAAAAGGAATAGTCCCATTAGCAAAGGTTGATTGCACTGCCAACACTAACACCTGTAATAAATATGGAGTCAGTGGATATCCAACCCTGAAGATATTTAGAGATGGTGAAGAAGCAGGTGCTTATGATGGACCTAGGACTGCTGATGGAATTGTCAGCCACTTGAAGAAGCAGGCAGGACCAGCTTCAGTGCCTCTCAGGACTGAGGAAGAATTTAAGAAATTCATTAGTGATAAAGATGCCTCTATAGTAGGTTTTTTCGATGATTCATTCAGTGAGGCTCACTCCGAGTTCCTAAAAGCAGCCAGCAACTTGAGGGATAACTACCGATTTGCACATACGAATGTTGAGTCTCTGGTGAACGAGTATGATGATAATGGAGAGGGTATCATCTTATTTCGTCCTTCACATCTCACTAACAAGTTTGAGGACAAGACTGTGGCATATACAGAGCAAAAAATGACCAGTGGCAAAATTAAAAAGTTTATCCAGGAAAACATTTTTGGTATCTGCCCTCACATGACAGAAGACAATAAAGATTTGATACAGGGCAAGGACTTACTTATTGCTTACTATGATGTGGACTATGAAAAGAACGCTAAAGGTTCCAACTACTGGAGAAACAGGGTAATGATGGTGGCAAAGAAATTCCTGGATGCTGGGCACAAACTCAACTTTGCTGTAGCTAGCCGCAAAACCTTTAGCCATGAACTTTCTGATTTTGGCTTGGAGAGCACTGCTGGAGAGATTCCTGTTGTTGCTATCAGAACTGCTAAAGGAGAGAAGTTTGTCATGCAGGAGGAGTTCTCGCGTGATGGGAAGGCTCTGGAGAGGTTCCTGCAGGATTACTTTGATGGCAATCTGAAGAGATACCTGAAGTCTGAACCTATCCCAGAGAGCAATGATGGGCCTGTGAAGGTAGTGGTAGCAGAGAATTTTGATGAAATAGTGAATAATGAAAATAAAGATGTGCTGATTGAATTTTATGCCCCTTGGTGTGGTCACTGTAAGAACCTGGAGCCCAAGTATAAAGAACTTGGCGAGAAGCTCAGCAAAGACCCAAATATCGTCATAGCCAAGATGGATGCCACAGCCAATGATGTGCCTTCTCCATATGAAGTCAGAGGTTTTCCTACCATATACTTCTCTCCAGCCAACAAGAAGCTAAATCCAAAGAAATATGAAGGTGGCCGTGAATTAAGTGATTTTATTAGCTATCTACAAAGAGAAGCTACAAACCCCCCTGTAATTCAAGAAGAAAAACCCAAGAAGAAGAAGAAGGCACAGGAGGATCTCTAAAGCAGTAGCCAAACACCACTTTGTAAAAGGACTCTTCCATCAGAGATGGGAAAACCATTGGGGAGGACTAGGACCCATATGGGAATTATTACCTCTCAGGGCCGAGAGGACAGAATGGATATAATCTGAATCCTGTTAAATTTTCTCTAAACTGTTTCTTAGCTGCACTGTTTATGGAAATACCAGGACCAGTTTATGTTTGTGGTTTTGGGAAAAATTATTTGTGTTGGGGGAAATGTTGTGGGGGTGGGGTTGAGTTGGGGGTATTTTCTAATTTTTTTTGTACATTTGGAACAGTGACAATAAATGAGACCCCTTTAAACTGTCTTATTTTCCACCAGATTGAGAACCAGATGTTCTCTACACACTATCACTGTTCAATAGAGCTTTCTTCAGTGATGGAAATGCTCTGTAATCTACACTGTTCAGTACAGGTAGCTACGGAGCATCTGAAATATGGCTAGAAACTACATTTTTGTTTTGATTAATTTAAATAGCCATACAGTTGCTACCATACTGGTCACGGCAGCTGTAGACTGACTGGGTCCATAGTTCATCACCTCAAAATTCTTTCAAAATTTATTATCTCTTTCTCTCCTTACATGTTTATTTCCCAGGCCTACCCTGGTGATTAGAACAGCTGAAGGGCCTTTCTTGTTAGGCTGTCCATGCCCTAAGGATGGGTTCCTGTTTATCCTTGCCACGCAGCTGAGCTTACTGCATGTTTATATCTCCCAAGGACTGTTCTCTGCTCAGAAATGCCCTGTCAAGGGTGTGGCATCACGCAGTTTCATCCAAGTTGTTTCAGGAATTGCTGACACTGCTGGGTGCAGTTCTATCCCCTAAAGCCTAGGGTGTGGCCCTTTAACTTCCCCTTCAGTAGAACTGGGAAAGGCAGTACCATTCCTAGTTATGAGTGAAGCATCCACTTTCTTTTGTAACAATGAGGAACAGAAAGGATAAGACTGAAGAGTGATCTTTTGTCCAACTAAACCATTTATCTCCTTTTGTAGGTAAATTCAAATCCTGCCCAGTTATAGTTTTCAGTCACTGGAGAATTCCAGGTAGGAGCCCTACTTTAGGTGATCCTAGGAACTCCTATGTTCAGAAAAGAATTTTCTTCCTACTATATAATTACAGTATTTAGCTGTCAATTTTAAGATGAATTTGGTAGAGCCTTATAGTAAAGTATGTATCTTGGTCACACACAAAGCTTGGAAAAAGTAAAAGATGTCTAAACCATAATCTTGTAACTCATAACATCTGGGCTGGGGCCCGGGGATCTAATTGTTTAGAGAGCCCCAAAAGTGGCTCAGATGTAAAGCCAGGGTTAAGAACCATCTGCCTTGGAAGATTTAAGGGAAACATATAAACTTGTACAAAGGACACAGAAGCAGTCAGTTTTAATTTTTTAGCCATGTTGGTAAAAGTTCATTTTCAGTACATGGGTAACACCCAGGCCCTTTCCCATTATATCCAGGTATGCTACAAGTTCTTTTAACTCTTATCAGAAGTTATTATTACTGTTTCCTTAGAGAGGCTACCAGGCTAAAATTCACTTAGTTTGGTTTGTCTAATGTCCTCATTATTTTATCCTGAAGATGATGTCATTTCTCAGGACTTGAAAATGACTTGGCTGAACTAAAGGTAAAAAAGCCAAGCCTCTGTCACTTTTCCTAGACTCCTAGGCACAGCTATGGAGTCTTTGCACAGTGCCCATACCCTAAAAATTAATAATGAAAACCAAACCTCAAGAACCTAGAGCAGCTCTCTACTTGCCACCATGGACTCCAGTGGTCAGCATAAGAAAAGCAGATAGTTGCATTCTATTTAGTTTATAGCTGCTTTGTTCCTTTGTGTTTCACTAAGCAGAGGCTCAAAAATTCCCTTGATAACTTCAGCTGCCCCTGTTCTTTTCCTCAAACTCCAGGATGAGACCTTTAATGTGGGACAATTTCTGGTGAAGGTACTCACAGCGACGCTTTTCTTCTCTGTAACTTGGGTACTGCTGCAGAGAAAAAGCATCCATGTCAAAAAGTAAAAATTCTCATTCTAC