Transcript asmbl_43548

Sequence
Transcript Sequence for observation asmbl_43548 of TGE0000491:
CGCAGAATTTAGTCCCACCGAAAGGGCAACCTGCCCGCGCGTTCCGCCGCCGCCGCCGCGCTTCCTCCTGAAGGACCTCAGCAGCCATGTCGAAGCCCCATAGTGAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTCCTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAGCAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAGAAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATCCAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGCAAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAGATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCCAGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTCTTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGTGCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGTGATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCCAAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATTGCCCGTGAGGCAGAGGCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCGCCTGGCGCCCATTACCAGCGACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTCCTTCAAGTGCTGCAGTGGGGCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCACGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTACCGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTGGACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGAGATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGTGTTGTTCCTGTGCCGTGATGGACCCCAGAGCCCCTCCTCCAGCCCCTGTCCCACCCCCTTCCCCCAGCCCATCCATTAGGCCAGCAACGCTTGTAGAACTCACTCTGGGCTGTAACGTGGCACTGGTAGGTTGGGACACCAGGGAAGAAGATCAACGCCTCACTGAAACATGGCTGTGTTTGCAGCCTGCTCTAGTGGGACAGCCCAGAGCCTGGCTGCCCATCATGTGGCCCCACCCAATCAAGGGAAGAAGGAGGAATGCTGGACTGGAGGCCCCTGGAGCCAGATGGCAAGAGGGTGACAGCTTCCTTTCCTGTGTGTACTCTGTCCAGTTCCTTTAGAAAAAATGGATGCCCAGAGGACTCCCAACCCTGGCTTGGGGTCAAGAAACAGCCAGCAAGAGTTAGGGGCCTTAGGGCACTGGGCTGTTGTTCCATTGAAGCCGACTCTGGCCCTGGCCCTTACTTGCTTCTCTAGCTCTCTAGGCCTCTCCAGTTTGCACCTGTCCCCACCCTCCACTCAGCTGTCCTGCAGCAAACACTCCACCCTCCACCTTCCATTTTCCCCCACTACTGCAGCACCTCCAGGCCTGTTGCTATAGAGCCTACCTGTATGTCAATAAACAACAGCTGAAGCACC