Transcript asmbl_43454

Sequence
Transcript Sequence for observation asmbl_43454 of TGE0057029:
GTGCTCTGCGAGGCCGCCTTCCGCCGGTGGCCTTCCTGTGGGCGGGAGAGGGCGGCCGGGAGCCCAATGAGGGAGCAATAACGTGGCAACCACCCACGAGCCCGCGTCGGTGCCCGCCCCGCAGGGGGACCTACTATCCGGCGCCGAGCCGGAGGGGGGAAACGGCGCCCGCCGCCCGCCCGGAGCCCGCGAGCAACCCCAGTCCCCCCCACCCGCGCGTGGCGGCGCCGGCTCCCTAGCCACCGCGGCCCCACCCTCTTCCGGCCTCAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGGTCCGTCTTCTTCCTGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCCAAAGTCACCGTCAAGGTGTATTTTGACCTACGAATTGGAGATGAAGATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAGCCCTTTGCCATCGCCAAGGAGTAGGGCACAGGGACATCTTTCTTTGAGTGACCGTCTGTGCAGGCCCTGTAGTCCGCCACAGGGCTCTGAGCTGCACTGGCCCCGGTGCTGGCATCTGGTGGAGCGGACCCACTCCCCTCACATTCCACAGGCCCATGGACTCACTTTTGTAACAAACTCCTACCAACACTGACCAATAAAAAAAAATGTGGGTTTTTTTT