Transcript asmbl_43429

Sequence
Transcript Sequence for observation asmbl_43429 of TGE0057028:
GCCTCGCCTCGCCTAGGGAGGATGTGGCGGGTATAAAAGCCCCACCCAGGCCAGCCGGCTCTGCTCAGCATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGCTTCCTTCAAAATGTCTACTGTTCACGAAATCCTGTGCAAGCTCAGCTTGGAGGGTGATCACTCTACACCCCCAAGTGCATATGGGTCTGTCAAAGCCTATACTAACTTTGATGCTGAGCGGGATGCTTTGAACATTGAAACAGCCATCAAGACCAAAGGTGTGGATGAGGTCACCATTGTCAACATTTTGACCAACCGCAGCAATGCACAGAGACAGGATATTGCCTTCGCCTACCAGAGAAGGACCAAAAAGGAACTTGCATCAGCACTGAAGTCAGCCTTATCTGGCCACCTGGAGACGGTGATTTTGGGCCTATTGAAGACACCTGCTCAGTATGACGCTTCTGAGCTAAAAGCTTCCATGAAGGGGCTGGGAACCGACGAGGACTCTCTCATTGAGATCATCTGCTCCAGAACCAACCAGGAGCTGCAGGAAATTAACAGAGTCTACAAGGAAATGTACAAGACTGATCTGGAGAAGGACATTATTTCGGACACATCTGGTGACTTCCGCAAGCTGATGGTTGCCCTGGCAAAGGTTGGTTTCCCAGTTTCTTTCTTTGCCCTTGCTTCCTCCCAAGGCAAGTCACATACCTCATTTTATACTTGGAGTGAATTAACTAAATCCCCTGTGCCTGCATCAGAAATTCAGCTGCATTTTTGAAAGTGGGTTTGCACTGTCACTGCAGAGTTGTCAATTTTGTATAATAGGATTTCTTATCCTGCAAAACCTCATGGACAAGTGGACTTTGGGAGCCAGAGAAGGGATGGGCGGCTCTCAAGTCCTGGCCTGGATTTATGTGCCAGAGCCTTGGC