Transcript asmbl_43160

Sequence
Transcript Sequence for observation asmbl_43160 of TGE0056226:
GCTGCCGCCGGAGCCGAGCCGACCCGCCCCGCCGACGAACCCCCTGAAGCTGTGCCAAGATGTGTGACGACGAGGAGACCACCGCCCTGGTGTGCGACAACGGCTCTGGGCTGGTGAAGGCCGGCTTTGCGGGCGATGACGCGCCCCGCGCTGTCTTCCCGTCCATCGTGGGCCGCCCGCGGCACCAGGGAGTTATGGTGGGTATGGGTCAGAAGGACTCCTACGTAGGTGATGAAGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTATCCCATCGAGCATGGTATCATCACCAACTGGGACGACATG