Transcript asmbl_42489

Sequence
Transcript Sequence for observation asmbl_42489 of TGE0056208:
CCGCTGCTCCAGCGGCCGCTGCCTTAGAAAAGTTAACGAGAACCAGATGTGGTGGCCACTGCCGAACTTTCTCAGAGCCGGTGATTGGTCCCCAGCCGAGGGCCTCAGCCAATTAGCTTGCTGGGTGGGCCTGGAGTCCCGCCCCGCCCAGGCGCCCGCGGAGATCCAGGTTCGAGGCTGGCGCGGCGCGGAGAGTGGGCTGGAGGCCGGGGCGGGACGCGTTGTGCAGCGGGTAAGCGCACGGCCGAGCGAGCATGGAGGGGGACCGGGTGGCCGGGCGGCCGGTGCTGTCGTCGTTACCAGTGCTACTGCTGCTGCCGTTGCTAATGTTGCGGGCCGCGGCGCTGCACCCAGACGAGCTCTTCCCACACGGGGAGTCGTGGGGGGACCAGCTCCTGCAGGAAGGCGACGACGAAAGCTCAGCCGTGGTGAAGCTGGCGAATCCCCTGCACTTCTACGAAGCCCGATTCAGCAACCTCTACGTGGGCACCAACGGCATCATCTCCACTCAGGACTTCCCCAGGGAAACGCAGTATGTGGACTATGATTTCCCCACCGACTTCCCGGCCATCGCCCCTTTTCTGGCGGACATCGACACGAGCCACGGCAGAGGCCGAGTCCTGTACCGAGAGGACACCTCCCCCGCAGTGCTGGGCCTGGCCGCCCGCTATGTGCGCGCTGGCTTCCCGCGCTCTGCGCGCTTTACCCCCACCCACGCCTTCCTGGCCACCTGGGAGCAGGTAGGCGCTTACGAGGAGGTCAAGCGCGGGGCGCTGCCCTCGGGAGAGCTGAACACTTTCCAGGCAGTTTTGGCATCTGATGGGTCTGATAGCTACGCCCTCTTTCTTTATCCTGCCAACGGCCTGCAGTTCCTTGGAACCCGCCCCAAAGAGTCTTACAATGTCCAGCTTCAGCTTCCAGCTCGGGTGGGCTTCTGCCGAGGGGAGGCTGATGATCTGAAGTCAGAAGGACCATATTTCAGCTTGACTAGCACTGAACAGTCTGTGAAAAATCTCTATCAACTAAGCAACCTGGGGATCCCTGGAGTGTGGGCTTTCCATATCGGCAGCACTTCCCCGTTGGACAATGTCAGGCCAGCTGCAGTTGGAGACCTTTCCGCTGCCCACTCTTCTGTTCCCCTGGGACGTTCCTTCAGCCATGCTACAGCCCTGGAAAGTGACTATAATGAGGACAATTTGGATTACTATGATGTGAATGAGGAGGAAGCTGAATACCTTCCGGGTGAACCAGAGGAGGCATTGAATGGCCACAGCAGCATTGATGTTTCCTTCCAATCCAAAGTGGATACAAAGCCTTTAGAGGAATCTTCCACCTTGGATCCTCACACCAAAGAAGGAACATCTCTGGGAGAGGTAGGGGGCCCAGATTTAAAAGGCCAAGTTGAGCCCTGGGATGAGAGAGAGACCAGAAGCCCAGCTCCACCAGAGGTAGACAGAGATTCACTGGCTCCTTCCTGGGAAACCCCACCACCGTACCCCGAAAACGGAAGCATCCAGCCCTACCCAGATGGAGGGCCAGTGCCTTCGGAAATGGATGTTCCCCCAGCTCATCCTGAAGAAGAAATTGTTCTTCGAAGTTACCCTGCTTCAGGTCACACTACACCCTTAAGTCGAGGGACGTATGAGGTGGGACTGGAAGACAACATAGGTTCCAACACCGAGGTCTTCACGTATAATGCTGCCAACAAGGAAACCTGTGAACACAACCACAGACAATGCTCCCGGCATGCCTTCTGCACGGACTATGCCACTGGCTTCTGCTGCCACTGCCAATCCAAGTTTTATGGAAATGGGAAGCACTGTCTGCCTGAAGGGGCACCTCACCGAGTGAATGGGAAAGTGAGTGGCCACCTCCACGTGGGCCATACACCCGTGCACTTCACTGATGTGGACCTGCATGCGTATATCGTGGGCAATGATGGCAGAGCCTACACGGCCATCAGCCACATCCCACAGCCAGCAGCCCAGGCCCTCCTCCCCCTCACACCAATTGGAGGCCTGTTTGGCTGGCTCTTTGCTTTAGAAAAACCTGGCTCTGAGAACGGCTTCAGCCTCGCAGGTGCTGCCTTTACCCATGACATGGAAGTTACATTCTACCCGGGAGAGGAGACGGTTCGTATCACTCAAACTGCTGAGGGACTTGACCCAGAGAACTACCTGAGCATTAAGACCAACATTCAAGGCCAGGTGCCTTACGTCTCAGCAAATTTCACAGCCCACATCTCTCCCTACAAGGAGCTGTACCACTACTCCGACTCCACTGTGACCTCTACAAGTTCCAGAGACTACTCTCTGACTTTTGGTGCAATCAACCAAACATGGTCCTACCGCATCCACCAGAACATCACTTACCAGGTGTGCAGGCACGCCCCCAGACACCCGTCCTTCCCCACCACCCAGCAGCTGAACGTGGACCGGGTCTTTGCCTTGTATAATGACGAAGAAAGAGTGCTTAGATTTGCTGTGACCAATCAAATTGGCCCGGTCAAAGAGGATTCAGACCCCACTCCGGGGAATCCTTGCTATGATGGGAGCCACATGTGTGACACAACAGCACGGTGCCATCCAGGGACAGGTGTAGATTACACCTGTGAGTGCGCATCTGGGTACCAGGGAGATGGACGGAACTGTGTGGATGAAAATGAATGTGCAACTGGCTTTCATCGCTGTGGCCCCAACTCTGTATGTATCAACTTGCCTGGAAGCTACAGGTGTGAGTGCCGGAGTGGTTATGAGTTTGCAGATGACCGGCATACTTGCATCTTGATCACCCCACCTGCCAACCCCTGTGAGGATGGCAGTCATACCTGTGCTCCTGCTGGGCAGGCCCGGTGTGTTCACCATGGAGGCAGCACGTTCAGCTGTGCCTGCCTGCCTGGTTATGCCGGCGATGGGCACCAGTGCACTGATGTAGATGAATGCTCAGAAAACAGATGTCACCCTGCAGCTACCTGCTACAATACTCCTGGTTCCTTCTCCTGCCGTTGTCAACCCGGATATTATGGGGATGGATTTCAGTGCATACCTGACTCCACCTCAAGCCTGACACCCTGTGAACAACAGCAGCGCCATGCCCAGGCCCAGTATGCCTACCCTGGGGCCCGGTTCCACATCCCCCAATGCGACGAGCAGGGCAACTTCCTGCCCCTACAGTGTCATGGCAGCACTGGTTTCTGCTGGTGCGTGGACCCTGATGGTCATGAAGTTCCTGGTACCCAGACTCCACCTGGCTCCACCCCGCCTCACTGTGGACCATCACCAGAGCCCACCCAGAGGCCCCCGACCATCTGTGAGCGCTGGAGGGAAAACCTGCTGGAGCACTACGGTGGCACCCCCCGGGATGACCAGTACGTGCCCCAGTGCGATGACCTGGGCCACTTCATCCCCCTGCAGTGCCACGGAAAGAGCGACTTCTGCTGGTGTGTGGACAAAGATGGCAGAGAGGTGCAGGGCACCCGCTCCCAGCCAGGCACCACCCCTGCGTGTATACCCACCGTCGCTCCACCCATGGTCCGGCCCACGCCCCGGCCAGATGTGACCCCTCCATCTGTGGGCACCTTCCTGCTCTATACTCAGGGCCAGCAGATTGGCTACTTACCCCTCAATGGCACCAGGCTTCAGAAGGATGCAGCTAAGACCCTGCTGTCTCTGCATGGCTCCATAATCGTGGGAATTGATTACGACTGCCGGGAGAGGATGGTGTACTGGACAGATGTTGCTGGACGGACAATCAGCCGTGCTGGTCTGGAACTGGGAGCAGAGCCTGAGACGATCGTGAATTCAGGTCTGATAAGCCCTGAAGGACTTGCCATAGACCACATCCGCAGAACAATGTACTGGACGGACAGTGTCCTGGATAAGATAGAGAGCGCCCTGCTGGATGGCTCTGAGCGCAAGGTCCTCTTCTACACAGATCTGGTGAATCCCCGTGCCATCGCTGTGGATCCAATCCGAGGCAACTTGTACTGGACAGACTGGAATAGAGAAGCTCCTAAAATTGAAACGTCATCTTTAGATGGAGAAAACAGAAGAATTCTGATCAATACAGACATTGGATTGCCCAATGGCTTAACCTTTGACCCTTTCTCTAAACTGCTCTGCTGGGCAGATGCAGGAACCAAAAAACTGGAGTGTACACTACCTGATGGAACTGGACGGCGTGTCATTCAAAACAACCTCAAGTACCCCTTCAGCATCGTAAGCTATGCAGATCACTTCTACCACACAGACTGGAGGAGGGATGGTGTTGTATCAGTAAATAAACATAGTGGCCAGTTTACTGATGAGTATCTCCCAGAACAACGATCTCACCTCTACGGGATAACTGCAGTCTACCCCTACTGCCCAACAGGAAGAAAGTAAGTACAGTAATGTAAAGGAAGACTTGGAGTTTACAATCAGAACCTGGACCCTAAAGAACAGTGACTGCAAAGGCAAAGAAAGTAAAAAAGGAATTGGCCATTAGACGTTCCTGAGCATCCAAGATGAACATTTTGTAGTGCAAAAAGACTTTTGTGAAAAGCTGATACCTCAATCTTTACTACTGTATTTTTAAAAATGAAGGTTGTTATTGCAAGTTTAAAAAGGTAACAGAATTTTAACTGTTGCTTATTAAAGCAACTTCTTGTAAACATTTATCATTAATATTTAAAAGATCAAATTCATTCAACTAAGAATTAGAGTTTAAGACTCTAAACCTGATTTTTGCCATGGATTCCTTCTGGCCAAGAAATTAAAGCACATGTGATCAATATAACAATATAATCCTAAACCTTGACAGTTGGAGAAGCCAATGCAGAACTGATGGGAAAGGACCAATTATTTATAGTTTCCCAACAAAAGTTCTAAGATTTTTTACCTCTGCATCAGTGCATTTCTATTTATATCAAAAGGTGCTAAAATGATTCAATTTGCATTTTCTGATCCTGTAGTGCCTCTATAGAAGTACCCACAGAAAGTAAAGTATCACATTTATAAATACCAAAGATGTAACAATTTTAAAATTTTCTAGATTACTCCAATAAAGTGTTTTAAGTTTTCCTATGACTTAAGGATCTATATTGTCTCTAGGACAAAGCTGGGGGTTGGCATATATGCCTTAACCACAAAGGAGAAAGGTGATTTATGCAAACATACAGTACATAATAAAAATTCTACTTTCCTAAACTTTATTAAAGAAAAAAGCAATAAGCAATGGTGGTAAATCTCTAGAACATACCCAATTTTCTGGGCTTCCTCCCCCGAGAATGTGACATTTTGATTTCCAAACATGCCAGAAGTGTATGGTTCCCAACTGTACTAAGTAGGTGAGAAGCTGAAGTCCTCAAGTGTTCATCTTCCAACTTTTCCCAGTCTGTGGTCTGTCTTTGGATCAGCAATAATTGCCTGAACAGCTACTATGGCTTCGTTGATTTTTGTCTGTAGCTCTCTGAGCTCCTCTATGTGCAGCAATCGCAGAATTTGAGCAGCTTCATTAAGAACTGCATCTGTTTTATGAGAAAAGAACACTGCTTCAATACATAATTTTTACATTTAAGGCCATTTATTTCCTCCCAAGTATTCAGTCTGTAAAAAAAATAGTTTGAATTTAAACAAAATCACTTACCTCCTGTGTCAAAACCAAGAATATGTTTGTCTAAAGCAACAGGTAAGCCCTTTAAAAAAAGAAAGACAAAATGAGAGTATTTATGGTTAAGAATAGCATCCTTTCCTCAACTGAAACTGAAAAGCACCTAGCTATTCTGGTGTCTTAACTCTTTTAGCTGCATGGGCAAGGGAACTAGGAATTTTGTTTATATTTGCTTTGTGATGATTGTGATTAGCGAGTTTTCCCTATTTCAACCGGTTAGGGGGAAAAGTTAACCTTTAAATGTACCAGGAAGCTCTATAGCTCATCCAATCCTTTAGCCCAGGCATACAAAACAATATATCCTTATTGCAGCAGTGCCTTGTCATTACTGCTATGGAAGGCAAGTTGAGCCAGGCTGTTACTGTCTTATTTTGGCGACAGTAAGCAACAGTATAAACGGCAAAAATAGTACCTTATATTCCATTTCTGAGCACATTAATTTGTCTTTACAAATTGTACGAACCTTTCAGCCAGCATGGTGTTTGCCAAGATTATGTATAATTATGTATAATTTAACTTTCAAGACTTGACTTGGAAGTTACTTTGAAACAAACAGTCTAGGAAAATGAAAAACTAAACCACTCAGCACCTATGGACATACTAAAGATGGTGACTATGGTGATGCCAAACTTCACAGAAACAAATTCTAAAATGAGGACAGTCTGTACTTCCTGCTGATTATATAAAATCACTGCCAAGAAAAACACACTACCCGTACTTTCAATCTTTCAATGTTACAACCTGTTACTATTCAAATGCTTTAGTCACTGCTCAATTCTTGCCTTATCTAGTAATGTAAATCTACGTAGGCTCTGTCTGCTTTAAAACAGCTAACACATGTAAGTCTGAAGAAACCAATGGGTACGAAAGCACAAGTGAGCAAAATTAAAGAGCAGAATTGTACTGAGTGGCTTTATATGTTCATCTAGTACCAGAGGCTCCACTTTTTTTTCCTTTGCCAACAGGCCACCAAGCTACCCCTGAAAACTACCATATGCCTCAAATAGTAGTTATAAATGCTTATAAGTACACTAGACTGTAAGAACTCCACTAAATTGTTATAGGCTGGTATCTTTTGAGATGACACCAAAATTAAAATTGGGAGCATTAAAAATAAAACTAAATTTTACTTTACAAACAAGAGCAAAGAGATTTGGCTAAGCCTTTACTTACACTGCCTTCCAAAGCATAGTTTTGCTGAAGGAATGAATGAATGAATGATTGACTTTATTACACCAGAACAATTTACTGTCTGTTCTATAGGGAGGGTGAAATAAGCTGATCTTTAACCCAACTTCCAGTGGCTCGATTCATATACAACGAGCCAGTAAGAACCTTTAAAAGAAAACAGTGTCTTTCAGAGATACTGCCCTGGCATTAGTAACCTTTTAACACTGCTTGGCCTGCCTAAAGGGGCTGGAGGACAAAAGGCATTGGGAGATGGGGGAAGGGCGCAGGGAGGACAAACAACATAGTTGTGCCCAAGGCATTCACTACAACATCATTGCTGCAGGAGGCAGGTGTTATCAGACACTGCTGCTGCTGACCTGAGGACAGTCTCTCCACCGCTGCACAGCCAGTGAAACTTTAGGCATCTTTGGATTTCTGATATAATCTAAAAATGTTCCATATTTTCTCTTTAAGGGGAAGGTAGTCATGGGATATAGCTTTTCTCAGCCTACAAGGTAGGACTGAAAGATACCATTTCAGTCACCTGTACCTTGAACCTTACACTCCAACAGAACCCCCTGTCCCTTCACCTGGGCAGACTGACAAGCTCATGCAGACATCCACGCATGGACCCTTCTCCCCACCTACCGTAAGAGCACAGGCTCTCAAGTCAGACTGCCTGAGCTCAGTCACTTACCAACTAGGTGACCTTAGCCAAATTACTTTCTCATGTTTTATGCCAGGAAATTGAATAAAACAAGAATTTACTCTGAAGAAATAAGAGCAAGGATAGAATTTAGATAGAAAAAGAAAACTAATTTGTAGTGAGGTGTGTTCCTTCTTCTCCAGCATGAGTCAAAATAATCCAGTAAGTTTCATATGGGTAACTCATTTTAAATAAACTTCAACGGGCCACAAGCATGATTTGTGGACTGTGCATGAGCTATTTGTGGCTTTTTTAAGGTACAAAGTGAGAGGAACATGAAGTTTTTCACTCAAAAATGACCCCCTAGCCACTGAATACATTCAATTTGCTTTAGGAAGCACTGAAGTAAGCTATCCTTTCTCTAAGTTGTAGAACGTAGAATGGATATCTTAAACAGATACATGCAAAGTTTAAAATCACGGCCATACCAGAAGAAATGTTCATTAACAACTTATTTAGGATTTATAGAAACGTACCTCTTTTGTTTGATTTGCCTTAGCAACTGCATCCTGTGTCAGGCGCTCCTGAACCAAAATCCGAATTGCCTAAGAAACCCAAAAATATTTTTACTTTTTATAGGCTGTGTACCTGTCATCCTTTCTTCTATGAGCCCAGAGAATAAGGATGCTCATTTTGATGAAGTCAGAATTACCTAAGTTCATTAATAAACTCCCCATTAAATTAAAAATAAAAAAAACCCACTAATATAACGTAACCTTTCACACTTCTAGTATTTTAATAATGTTGAATGGTGCTTGCAACAATTAAAACCATTTTTTGAATAGGTAATGCACGTGACTGGTAAAAAACAACTTTAAATACAGCAAGACACATGGTAAAAAGTAGGTCTCCTTCCTACCTGAGCCTTGCGATCCCCTACAGATTCCTTACCCTCACTAAAACTGCGAAATGACGAGCATGCTTAGCACGAATACACATTTTTGACACAAAGGGTAGCAGATCATACATACTGTCTTACACTTTGCTTTTATCACTTCACTCTAGTAAAATATTTTCAAACCTTTCAAAGGACACCGTTGGTGGTTTTAATCACCAAGGCATTTCATTATGGTAGGCATGCATGCAAGTATCCATACACACTTAAAAATCAAATTTTAAAAAAATGGAATTTTAATTAGGAAGATGACAATTACAACTCAAAAATAAGTGTGAAAACTTAAACTATAATTTTTAAATAAAAAACCAAATGCTATCTTTGAAAAACCGAATTCAAACAATGTTTAACAGTTATTGCAGATGTTATTAAATAGTCTGGTTGCCAAACAGTTAATATACTGATGCTTGTACTTGGCAAACGTACTAAGATGTTTTCCATATTATGTTATTGTTTGAATGCCTCTTAAAATAACTCAAAAGGGACAAATGTGCAGCAGGACTAGAATTTTATAGCATTTTGTTGTAGTTGATTTATACTTTATCCCCTTGGGTTTTGAAGTCTAACAAAAGCATCCCAAATACGCTATGCATTGTCTGACTCTCCTCTCACTTACTTTATGATTAAAGCTGACATGATCACTATAGAACAGTTCCAAGGCAATTTACATAATTGTCGGAATAAAGAACAAGCCTTTGAAATAGCTAAATTTCACTAAAAACATTTTTGTCTTTTGGCATGCAATCTGGATTGAGAAAATCCAAGTTAACATTCAGATTCAGTATAGAAAATTTTAATAACTTAGGAATACAACAGTCTTGTTAAAACTGACATTTAATAATAAAAATCTAAAAAGCATGGTAAGTTATGGCTTAATCTCTTCTGGGTAGAGTGATATTTATCACAAAGTAGTTTACATGCACAAGGTCTAGTTAAAAGCTTTTAATCTCTTATAAAATTTCCAAGTCTGGTATCTTAAGTACCACTCCCCTGATCCACACCACTGTACTTTCACGATTACTAGGAATAAATCTTCTGAAGTTTATGATTTCTCTCAGAAACAAGAGACCTCTTTCAGATTACTGGGATTCCTGAAGTATAGTTATGAACTGAGTGGCCTATCTAGCATCGGGGACAGAAAGATTCATTTCTCAAAGAGATTTTGGGGTTATATATTTTTGACCAAATTCACCATTACTCATTTGGCATTTTCGACCATCTTAACAAATGCAGACTATGAATCATTAAAAAGACTAACTAAACAGAAGTAGGGTAATGTGGGAAAAACAATGGACCACAGGGTTATAGTGCTTAAAATCCTGGCTCTGTCATTTTCTGTGTCATCTTAGACATTATCCTCATTGAGTCTCAGTTTCTTCATATGATATATATTTTTAAAAAGATATTAGCAGCTGTCTCTAGGATTGTTGGCAGGATTGAATGAGAACATCTTTGCAAAGGATTTAGCATAGTGCAGGCAGAAAACAGAATCCAAATCAGATAAAACCATGAAATCTACTTTATGTTTCATATTCTTCTGTGTATTTTAGTCATTCAACCATAATTTTAATATCAATAGTTAATATTTAGAAAATAAAGACATTTTTCTATGTGCACAGTTTCTGTCAAGAATCAAGAACATGAAGCTGACCTTAAGCATTACCAGGTAATCATCATGACGCTGAATCTGAAGCAGGTTAGCCAAAGCCATCACACCAGCCTTAAAATCAGGATTATTTACTATAAAAGATTAAAAACAAACAAAAACTTACAACCCTGCAAACGTATAATTACAAACATATTTGTGAACATACAAAAACATTTTTAACTTTTCGGTAGCAACAAATCTCTTAGTTTTTAAAACTGCTACTCACAAGAGAAAAAAGAAAGCCCTGTAGACTATCAACAATTAAATAAATTGGTAAGATAAAATGGTTTTCCTATTACTGTATGAGACGGTCCCCAACTTAGGATGGTTAGACTTGTAATTTTTTGACCTTACAATGAGTTCAGTGGGATGTAACCCTAGTGCAAGATGAGGAAAATCTGAACTTACAGTGGTTCCAACTACAATTTTTCAGCTTTACAATGGGTCTTCCGGGGTATTAAATGCATTTTTGACTTATGATATTTTCGACTTTGGGACATGATCTCATCCTAAGTCAAGGAGTATCTGTATTTCATCAGCCAAACTGAATAATCCAATAAATGACTAATTTAACTCACATTATATTTGTCCTGTAACTTTTTCTGCAAGGCTAAATTATACAGCACTTTTAATTAACATTTCTTCCCAAGGCCATTAATTTTAGTACATAGATCCCCTCCATGGATAGTTTTCCCAAAACCTTCTCTCTAAGCAGCAGCTCTGGAGTGTCCAAGAGGCTCACTCATTCAAAAGGGTTAACTCCTAAATTATAGGTCACAATGAATTAGCCAGTGAACAAATATTTTACACATCATAATTTAGGTAATTAGATTCTTCATATTTTTAAAAAGGGAAATTACTAAAAGATATCCAGGACTTAAAATAATGGAAAATTTTACCACTTGTCTGATAGAGTCATTGGATTAAAAGAAATTTACACATTCAAAAAGGCAAACAATGACCCCCATGATTAAATACAAATCAAAACTCCAAATTACTAGAAGCAAATCAAATCAACATTCAGATATTCAAATGCAAGGGGAAGGAGAAAGCACATCATAAAAACATTATAGAGAATAAAATGTTAACATAAATGCTGTCTGCATGGATCCTTCTAAATTTACTAAAACCAAGTAAACCTGGACTTCATTCTTCAAAGAAAAAAACATTTAAAAAACCAAAAATGTTGATGTTCAATGTTATGCATTTATATACTCACCATCCAAATTGATCAATGGTTCTGCATTTTTAGTTGCATTGTCAGCAGTTTTTGAATTATCAGGTACTAAATCCTTGTATTTTTCAGCTATAAAAACAGGCAAAAATATAATTTGTACAACTGCAACTCAAGGTAAAATGACTACTGCTATTTACCAAATTTAACTGAGCCAAAATGATTACAGGTTGAGTTTCCCTTACTGGAAATGCCAATAATTTCCAATTTTAAATTTTTTCAGACTTCGGATTATCTGCATATATAAAATGGGATATTTTGGGGATGGGACTGAAGTCTAAACACAAAATTCATTTTTATGTTCAATGTACAACTTATACACATAGCCTGAAGGTAATTTCATATAATATTTTTAATAATTTTGTGCATGAA