Transcript asmbl_35754

Sequence
Transcript Sequence for observation asmbl_35754 of TGE0057016:
CGGAGACCTGAGCGCGGCGGGCCGAGCTCCCCAATTTGTTGGCGCTGCCCCCTCCCCCCCGGCGGTGCGCGGGCGGCGCCTCAAAGGGGAGGACCCTGCGGCGCGGGTAAGAGGCGGCGGGAGCGCGCGGCCCGGGAGTGTGGCTGCAGTGCGCCGGGACACCAGGGCTCCGCGCTCCGCACTCAAGAGGCTCCCGCGTCCCAACCCCTCGCGCCCGCGCGTTCGCGGATCCAGGCCGAGGACCGAAAGGGGCCGCCCGAGCCCCCGGGGCCGGCGCCCAGAGAGCCCAGCAAGGCCGGCCGCCCTGCCGGTGTGCCGCCGGCGGGTGCTTCTGGAAGGGCCAATGCGTTCGGGCAGCAGCCCCTGAAGCCGAGCCCGAGGCTAAGTGGGACTGACCGGGGCCCAGAGTGGACGAACCGCCAGCATGGGGAGAGACCAGCGCGCGGTGGCCGGCCCTGCCCTACGGCGGTGGCTGCTGCTGGGGACAGTGACCGTGGGGTTCCTCGCCCAGAGCGTCTTGGCGGGTGTGAAGAAGTTTGATGTGCCGTGTGGAGGAAGAGATTGCAGTGGGGGCTGCCAGTGCTACCCTGAGAAAGGTGGACGTGGTCAGCCTGGGCCAGTGGGCCCCCAGGGGTACAATGGGCCACCAGGATTACAAGGATTCCCGGGACTGCAGGGACGTAAAGGAGACAAGGGTGAAAGGGGAGCCCCCGGAGTAACGGGACCCAAGGGCGACGTGGGAGCAAGAGGCGTTTCTGGATTCCCTGGTGCCGATGGAATTCCTGGACACCCGGGGCAAGGTGGGCCCAGGGGAAGGCCGGGCTACGATGGCTGCAACGGAACCCAGGGAGACTCAGGTCCACAGGGGCCCCCCGGCTCTGAGGGGTTCACCGGGCCTCCCGGGCCCCAAGGACCAAAAGGGCAGAAAGGTGAGCCTTATGCACTGCCTAAAGAGGAGCGCGACAGATATCGGGGTGAACCTGGAGAGCCTGGATTGGTCGGTTTCCAGGGACCTCCCGGCCGCCCTGGGCATGTGGGACAGATGGGTCCAGTTGGAGCTCCAGGGAGACCAGGACCACCTGGACCCCCTGGACCAAAAGGACAGCAAGGCAACAGAGGACTTGGTTTCTACGGAGTTAAGGGTGAAAAGGGTGACGTAGGGCAGCCGGGACCCAACGGGATTCCATCAGACACCCTCCACCCCATCATCGCGCCCACAGGAGTCACCTTCCACCCAGATCAGTACAAGGGTGAAAAAGGCAGTGAGGGGGAACCAGGAATAAGAGGCATTTCCTTGAAGGGAGAAGAAGGAATCATGGGCTTTCCTGGACTGAGGGGTTACCCTGGCTTGAGTGGTGAAAAAGGATCACCAGGACAGAAGGGAAGCCGAGGCCTGGATGGCTATCAAGGGCCTGATGGACCCCGGGGACCCAAGGGAGAAGCCGGAGACCCAGGGCCCCCTGGACTACCTGCCTACTCCCCTCACCCTTCCCTAGCAAAAGGTGCCAGAGGTGACCCGGGATTCCCAGGGGCCCAAGGGGAGCCAGGAAGCCAGGGTGAGCCAGGAGACCCGGGCCTCCCAGGTCCCCCTGGCCTCTCCATCGGAGATGGAGATCAGAGGAGAGGCCTGCCGGGTGAGATGGGACCCAAGGGCTTCATCGGAGACCCCGGCATCCCTGCGCTCTACGGGGGCCCACCTGGACCTGATGGAAAGCGAGGGCCTCCAGGACCCCCCGGGCTCCCTGGACCACCTGGACCTGATGGCTTCCTGTTTGGGCTGAAAGGAGCAAAAGGAAGAGCAGGCTTCCCTGGGCTTCCCGGCTCCCCTGGAGCCCGCGGACCAAAGGGGTGGAAAGGTGACGCTGGGGAATGCAGATGTACAGAAGGCGACGAAGCTATCAAAGGTCTTCCGGGACTGCCAGGACCCAAGGGCTTCGCAGGCATCAACGGGGAGCCGGGGAGGAAAGGGGACAGAGGAGACCCCGGCCAACACGGCCTCCCTGGGTTCCCAGGGCTCAAGGGAGTGCCTGGCAACATTGGTGCTCCCGGACCCAAAGGAGCAAAAGGAGATTCCAGAACAATCACAACCAAAGGTGAGCGGGGACAGCCCGGCGTCCCAGGTGTGCCCGGGATGAAAGGTGACGATGGCAGCCCAGGCCGCGATGGGCTCGATGGATTCCCCGGCCTCCCAGGCCCTCCCGGTGATGGCATCAAGGGCCCTCCAGGGGACCCAGGCTATCCAGGAATACCTGGAACGAAGGGTACTCCAGGAGAAATGGGCCCCCCAGGACTGGGCCTTCCCGGCCTCAAAGGCCAACGTGGTTTCCCTGGAGACGCCGGCTTACCTGGACCACCAGGCTTCCTGGGCCCTCCTGGCCCCGCAGGGACCCCAGGACAAATAGATTGTGACACAGATGTGAAAAGGGCCGTTGGAGGTGACAGACAGGAGGCCATCCAGCCAGGTTGCATAGGAGGGCCCAAGGGATTGCCAGGCCTGCCAGGACCCCCAGGCCCCACAGGTGCCAAAGGCCTCCGAGGAATCCCAGGCTTCGCAGGAGCTGATGGAGGACCAGGGCCCAGGGGCTTGCCAGGAGACGCAGGTCGTGAAGGGTTCCCAGGACCCCCAGGGTTCATAGGACCCCGAGGATCCAAAGGTGCAGTGGGCCTCCCTGGCCCAGATGGATCCCCAGGTCCCATCGGCCTGCCAGGGCCAGATGGGCCCCCTGGGGAAAGGGGCCTCCCTGGAGAAGTCCTGGGAGCTCAGCCCGGGCCACGGGGAGATGCTGGTGTGCCTGGACAGCCTGGGCTTAAAGGCCTTCCCGGAGACAGAGGCCCCCCTGGATTCAGAGGAAGCCAAGGGATGCCTGGGATGCCAGGGCTGAAGGGCCAGCCAGGCCTCCCAGGACCTTCCGGCCAGCCAGGCCTGTATGGGCCTCCAGGACTGCATGGATTCCCAGGAGCTCCTGGCCAAGAGGGGCCCTTGGGGCTGCCAGGAATCCCAGGCCGTGAAGGTCTGCCTGGTGATAGAGGGGACCCTGGGGACACAGGCGCTCCTGGCCCTGTGGGCATGAAAGGTCTCTCTGGTGACAGAGGAGATGCTGGCTTCACAGGGGAGCAAGGCCATCCAGGAAGCCCTGGATTTAAAGGAATTGATGGAATGCCTGGGACCCCCGGGCTAAAAGGAGATAGAGGCTCACCTGGGATGGATGGTTTCCAAGGCATGCCTGGACTCAAAGGGAGACCCGGGTTTCCAGGGAGCAAAGGCGAGGCTGGATTTTTCGGAATACCCGGTCTGAAGGGTCTGGCTGGTGAGCCAGGTTTTAAAGGCAGCCGAGGGGACCCTGGGCCCCCAGGACCACCTCCTGTCATCCTGCCAGGAATGAAAGACATTAAAGGAGAGAAAGGAGATGAAGGGCCTATGGGGCTGAAAGGATACCTGGGCGCAAAAGGTATCCAAGGAATGCCAGGCATCCCAGGGCTGTCAGGAATCCCTGGGCTGCCTGGGAGGCCCGGCCACATCAAAGGAGTCAAGGGAGACATCGGAGTCCCCGGCATCCCCGGTTTGCCAGGATTCCCTGGGGTGGCTGGCCCCCCTGGAATTACGGGATTCCCAGGATTCATAGGAAGCCGGGGTGACAAAGGTGCCCCAGGGAGAGCAGGCCTGTATGGCGAGATTGGCGCGACTGGTGATTTCGGTGACATCGGGGACACTATAAATTTACCAGGAAGACCAGGCCTGAAGGGGGAGCGGGGCACCACTGGAATACCAGGTCTGAAGGGATTCTTTGGAGAGAAGGGAACAGAAGGTGACATCGGCTTCCCTGGGATAACAGGCGTGACTGGAGTCCAAGGCCCTCCTGGACTTAAAGGACAAACAGGCTTTCCAGGGCTGACTGGGCCTCCAGGGTCGCAGGGAGAGCTGGGGCGGATTGGACTGCCTGGTGGCAAAGGAGATGATGGCTGGCCGGGAGCTCCGGGCTTACCAGGTTTTCCGGGACTCCGTGGGATCCGCGGCTTACACGGCTTGCCAGGCACCAAGGGCTTTCCAGGATCCCCAGGTTCTGACATCCACGGAGACCCAGGCTTCCCAGGCCCTCCTGGGGAAAGAGGTGACCCAGGAGAGGCCAACACCCTTCCAGGCCCTGTGGGAGTCCCAGGACAGAAAGGAGACCAAGGAGCTCCAGGGGAACGAGGCCCACCTGGGAGCCCAGGACTTCAGGGGTTCCCTGGTATCACACCCCCTTCCAACATCTCTGGGGCACCTGGTGACAAAGGGGCGCCAGGGATATTTGGCCTGAAAGGTTATCGGGGCCCACCAGGGCCACCAGGTTCTGCTGCTCTTCCTGGAAGCAAAGGTGACACAGGGAACCCAGGAGCTCCAGGAACCCCAGGGACCAAAGGATGGGCCGGGGACTCCGGGCCCCAGGGCAGGCCTGGTGTGTTTGGTCTCCCAGGAGAAAAAGGGCCCAGGGGTGAACAAGGCTTCATGGGGAACACTGGACCCACTGGGGCGGTGGGCGACAGAGGCCCCAAGGGACCCAAGGGAGACCCAGGATTCCCTGGTGCCCCCGGGACTGTGGGAGCCCCCGGGATTGCAGGAATCCCCCAGAAGATTGCCGTCCAACCAGGGACAGTGGGTCCCCAGGGGAGGCGAGGCCCCCCTGGGGCACCGGGGGAGATGGGGCCCCAGGGCCCCCCCGGAGAACCAGGTTTCCGTGGGGCTCCAGGGAAAGCTGGGCCCCAAGGAAGAGGTGGTGTGTCTGCTGTTCCCGGCTTCCGGGGAGATGAAGGACCCATAGGCCACCAGGGGCCGATTGGCCAAGAAGGTG