Transcript asmbl_35329

Sequence
Transcript Sequence for observation asmbl_35329 of TGE0056520:
CCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCCTTCGCCTCCTTCACCGCCGCAGACCCCTTCAAGTTCTAGTCATGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATTGGCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGATGATTCCTTCAACACCTTCTTCAGTGAAACGGGTGCTGGCAAGCATGTGCCCCGGGCAGTGTTTGTAGACTTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACTTACCGCCAGCTCTTCCACCCTGAGCAACTCATCACAGGCAAGGAAGATGCTGCCAATAACTATGCCCGAGGGCACTACACCATTGGCAAGGAGATCATTGACCTCGTGTTGGACCGAATTCGCAAGCTGGCTGACCAGTGCACCGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGTGGGGGAACTGGTTCTGGGTTCACCTCGCTGCTCATGGAACGTCTCTCAGTTGATTATGGCAAGAAGTCCAAGCTGGAGTTCTCCATTTACCCGGCGCCCCAGGTTTCCACAGCTGTAGTTGAGCCCTACAACTCCATCCTCACCACCCACACCACCCTGGAGCACTCTGATTGTGCCTTCATGGTAGACAATGAGGCCATCTATGACATCTGTCGTAGAAACCTCGATATCGAGCGCCCAACCTACACTAACCTTAACCGCCTTATTAGCCAGATTGTGTCCTCCATCACTGCTTCCCTGAGATTTGATGGAGCCCTGAATGTTGACCTGACAGAATTCCAGACCAACCTGGTGCCCTACCCCCGCATCCACTTCCCTCTGGCCACATATGCCCCTGTCATCTCTGCTGAGAAAGCCTACCACGAACAGCTTACTGTAGCAGAGATCACCAATGCTTGCTTTGAGCCAGCCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCTTGCTGCCTGTTATACCGTGGTGACGTGGTTCCCAAAGATGTCAATGCTGCCATTGCCACCATCAAAACCAAGCGTACCATCCAGTTTGTGGATTGGTGCCCCACTGGCTTCAAGGTTGGCATTAATTACCAGCCTCCCACTGTGGTGCCTGGCGGAGACCTGGCCAAGGTACAGAGAGCTGTGTGCATGCTGAGCAATACCACAGCTGTTGCCGAGGCCTGGGCTCGCCTGGACCACAAGTTTGACCTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGGATGGAGGAAGGCGAGTTTTCAGAGGCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTATGAGGAGGTTGG