Transcript asmbl_35079

Sequence
Transcript Sequence for observation asmbl_35079 of TGE0056519:
CGTCCACATGCCGCGGCGGCGGCGAAAGGGGAGGCAGCGGCCGATAAATGCTATTAGAGCAGCCGCCGCGGAGCCGTCCCCGACGCCACCTCCTTTTCCTTCGCCGCAGTTTCCTCCGCCGCTGTCGGGCGTGCGGCGCTGAGGGACCCGGGCGAGCGCGCCGCGCACCGCCCCGCCGGCTCGCCTCCCTCGCCGCGTTCCGCCCTCAGTGGTCTGCCGGGCGCCCCCTCCTCCGGCCCGGGCGGGGCCTCTGATCGCCTCAAGAGAGCGGGGAGGGGGCTCGGGGGCCGCGGCCTGCCCTCCCGGCGGGCGGCTGAGGGCGAGGGAGGCCCTCCCTTCTGGCGAGGGGAGGGAGGGTGGGTCAGGAGCCCCCAACCCGCCCTGCGGAGCTCGGGGCCGCGCGAGGGGCGGTTGTCTGGGGGAGGGGGCGCGGGGTGATTCAGCGCCCGGCGAGGCGGAAGCGGCCGCAAGAGGAGGAGGGGAGAGCCCGTCCGCGCCTGGGCTCCCGGGGTGGCACGAGCCCGCGGCCGGAGTGCGAGGCGGAGGCGAGGAGGCCGCGGGGACGGGAGGCGAGGCCGGCCGGGCCCCCGAAGCCATGGAGAACGCGCACACCAAGACGGTGGAGGAGGTGCTGGGCCACTTCGGCGTCAACGAGAGTACGGGGCTGAGCCTGGAACAGGTCAAGAAGCTTAAGGAGAGATGGGGCTCCAACGAGTTACCGGCTGAAGAAGGAAAAACCTTGCTGGAACTTGTGATTGAGCAGTTTGAAGACTTGCTAGTTAGGATTTTATTACTGGCAGCATGTATATCTTTTGTTTTGGCTTGGTTTGAAGAAGGTGAAGAAACAATTACAGCCTTTGTAGAACCTTTTGTAATTTTACTCATATTAGTAGCCAATGCAATTGTGGGTGTATGGCAGGAAAGAAATGCTGAAAATGCCATCGAAGCCCTTAAGGAATATGAGCCTGAAATGGGCAAAGTGTATCGACAGGACAGAAAGAGTGTGCAGCGGATTAAAGCTAAAGACATAGTTCCTGGTGATATTGTAGAAATTGCTGTTGGTGACAAAGTTCCTGCTGATATAAGGTTAACTTCCATCAAATCTACCACACTAAGAGTTGACCAGTCAATTCTCACAGGTGAATCTGTCTCTGTCATCAAGCACACTGATCCCGTCCCTGACCCACGAGCTGTCAACCAAGATAAAAAGAACATGCTGTTTTCTGGTACAAACATTGCTGCTGGGAAAGCTATGGGAGTGGTGGTAGCAACTGGAGTTAACACCGAAATTGGCAAGATCCGGGATGAAATGGTGGCAACAGAACAGGAGAGAACACCCCTTCAGCAAAAACTAGATGAATTTGGGGAACAGCTTTCCAAAGTCATCTCCCTTATTTGCATTGCAGTCTGGATCATAAATATTGGGCACTTCAATGACCCGGTTCATGGAGGGTCCTGGATCAGAGGTGCTATTTACTACTTTAAAATTGCAGTGGCCCTGGCTGTAGCAGCCATTCCTGAAGGTCTGCCTGCAGTCATCACCACCTGCCTGGCTCTTGGAACTCGCAGAATGGCAAAGAAAAATGCCATTGTTCGAAGCCTCCCGTCTGTGGAAACCCTTGGTTGTACTTCTGTTATCTGCTCAGACAAGACTGGTACACTTACAACAAACCAGATGTCAGTCTGCAGGATGTTCATTCTGGACAGAGTGGAAGGTGATACTTGTTCCCTTAATGAGTTTACCATAACTGGATCAACTTATGCACCTATTGGAGAAGTGCATAAAGATGATAAACCAGTGAATTGTCACCAGTATGATGGTCTGGTAGAATTAGCAACAATTTGTGCTCTTTGTAATGACTCTGCTTTGGATTACAATGAGGCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTGCTCTCACTTGCCTAGTAGAGAAGATGAATGTATTTGATACCGAATTGAAGGGTCTTTCTAAAATAGAACGTGCAAATGCCTGCAACTCAGTCATTAAACAGCTGATGAAAAAGGAATTCACTCTAGAGTTTTCACGTGACAGAAAGTCAATGTCGGTTTACTGTACACCAAATAAACCAAGCAGGACATCAATGAGCAAGATGTTTGTGAAGGGTGCTCCTGAAGGTGTCATTGACAGGTGCACCCACATTCGAGTTGGAAGTACTAAGGTTCCTATGACCTCTGGAGTCAAACAGAAGATCATGTCTGTCATTCGAGAGTGGGGTAGTGGCAGCGACACACTGCGATGCCTGGCCCTGGCCACTCATGACAACCCACTGAGAAGAGAAGAAATGCACCTTGAGGACTCTGCCAACTTTATTAAATATGAGACCAATCTGACCTTCGTTGGCTGCGTGGGCATGCTGGATCCTCCGAGAATCGAGGTGGCCTCCTCCGTGAAGCTGTGCCGGCAAGCAGGCATCCGGGTCATCATGATCACTGGGGACAACAAGGGCACTGCTGTGGCCATCTGTCGCCGCATCGGCATCTTCGGGCAGGATGAGGACGTGACGTCAAAAGCTTTCACAGGCCGGGAGTTTGATGAACTCAACCCCTCCGCCCAGCGAGACGCCTGCCTGAACGCCCGCTGTTTTGCTCGAGTTGAACCCTCCCACAAGTCTAAAATCGTAGAATTTCTTCAGTCTTTTGATGAGATTACAGCTATGACTGGCGATGGCGTGAACGATGCTCCTGCTCTGAAGAAAGCCGAGATTGGCATTGCTATGGGCTCTGGCACTGCGGTGGCTAAAACCGCCTCTGAGATGGTCCTGGCGGATGACAACTTCTCCACCATTGTGGCTGCCGTTGAGGAGGGGCGGGCAATCTACAACAACATGAAACAGTTCATCCGCTACCTCATCTCGTCCAACGTCGGGGAAGTTGTCTGTATTTTCCTGACAGCAGCCCTTGGATTTCCCGAGGCTTTGATTCCTGTTCAGCTGCTCTGGGTCAATCTGGTGACAGATGGCCTGCCTGCCACTGCACTGGGGTTCAACCCTCCTGATCTGGACATCATGAATAAACCTCCCCGGAACCCAAAGGAACCATTGATCAGCGGGTGGCTCTTTTTCCGTTACTTGGCTATTGGCTGTTACGTCGGCGCTGCTACCGTGGGTGCTGCTGCATGGTGGTTCATTGCTGCTGACGGTGGTCCAAGAGTGTCCTTCTACCAGCTGAGTCATTTCCTACAGTGTAAAGAGGACAACCCGGACTTTGAAGGCGTGGATTGTGCAATCTTTGAATCCCCATACCCGATGACAATGGCGCTCTCTGTTCTAGTAACTATAGAAATGTGTAACGCCCTCAACAGCTTGTCCGAAAACCAGTCCTTGCTGAGGATGCCCCCCTGGGAGAACATCTGGCTCGTGGGCTCCATCTGCCTGTCCATGTCACTCCACTTCCTGATCCTCTATGTCGAACCCTTGCCACTCATCTTCCAGATCACACCGCTGAACGTGACCCAGTGGCTGATGGTGCTGAAAATCTCCTTGCCCGTGATTCTCATGGATGAGACGCTCAAGTTTGTGGCCCGCAACTACCTGGAACCTGGTAAAGAGTGTGTGCAGCCTGCCACCAAATCCTGCTCGTTCTCGGCATGCACCGATGGGATTTCCTGGCCGTTTGTGCTGCTCATAATGCCCCTGGTGATCTGGGTCTATAGCACAGACACTAACTTTAGCGATATGTTCTGGTCTTGACTGACAGTTTTCCATAAAGAAGATGTTTAACTTAATCAATTAATTTTTTTATTGTTTAAAGCAACTGTCTATTTCTGCTGAATTTTCACATGAACATACTGGCTGGTGATGGAGGTTTCATACTCTAGATTTTGTTTTGCTTTTTCTGACTCCAGTGGGGCAAGATTTTCCTTTTTTATACACATAATTAAAGTGTCCATTGACATGTACAGAGAACTAACACTATTTTATGCAAATATTTTTTTGTAGATGAAAAAGCATGTACAGTGTTCTGTTTAATACTCATCCTTGTATAAAAAAAATAGTTGAGCCAGCAGACATTGTCAGCAAATTAATTGGCAGCAGATTTTAGGAAATGAATGTGTGTGGTTTTTTTTCTAAAACTAAATAGCATGTATTGTGTCTTTTGCATGATGATCCGGATTTAATTTGATATCACAGTCTAATTTTTATTCATAAGCCAATTTTTCTGCACTGAGCAGAGTCTTGCTACCTCAGTCAGTATTGTTTTGGTTTGCTACTTCCCTCACCCACTTTGGCCTCCGTTCACCCCACCCCACCCCACCTCTCCCCACCTTACCCCCGCCCCGCTTGGCTTCTTCTTTAGGATTGTGATGGTTCGTTCTGTTTACATCAGTTTTAACGAGAGGTATGCCTGTACTCGCTTGTGCAGAAAACATTGTTCCAGATTCAATCGACTGGGTTTATGTCCCTTCACATAGTTTTTAAGGTTATTTATTTAAATGTCTAATGTATTTTATTGTAACAGACATTGTTTTGCCAACATTGCCTATTTCAGTGGCACGTCATCTAGTTTTAAAAAAATAAAACATTTTAAATGGACAGAGAAAAATAACTGTCTTGTCTTTAACTCGTAAGTGGCTTACCTGGGACTAACAGACATGTCCAACTTTCTCTCCAGTTCTTAGCTCAGAACTTTAGTTGTACTCTGCTTGAGGGGAAGAAGGCTCCTGCTCTGCTGTGTAGGTAGTCATAGGAATTGTATTCTTAATGTACAGGCACTAATTGTCATCTGTGATGTACATTTTATGCAAGTTTCTGCTGGCCTGGTATAGAGAACATAAGGGCAAGTGTGTATGTGTGTGTATGTGTGTGTTTTGTAAAATCTGTAAATAGCACATGACCAAATGAACATATTGTATAGAACTATTTTTATTTGAATGTGGCACTAACCACCACCACCGTTACTACGATCAATGTTTGCGCATGTTCGAGATGAGTCTCACCAACAGTGTGTAAGTCATTAACAGTCCTAACTGTGGTGTTTTCCTCCAATGCCTTCCAACATCCATCAACTAACGTGAGTATTTTCTTCCTGGGATTTGGATGCTTTAGCCTAAAGGTGACTGCCACCAAGTGAGATAACTGTATGTCACTAACTTATAAGCCGCCTCCATGGCAGATGCTGCTGTGCTCCCTGATGCCCTGTGAGCACCGGGGTTGCCTGTGGCGCCTGCCATGTGACTCGGGCGCAGCATCAGCTGGCTGGAGGTGTGGCTTTCATAGACCTCCACAGGCTGCCTAGGACAAGATGACCAGGAGGGCCCAAGCCAGACAAAAGCCGGAGTGGGGAGAGAGGCATTTCAGCCAGACCAACAGGCTGAAGGAGCTGTGCAGACTATTGCTAAAATGAGGGTTCGCAGCTGCCAGGAGTCATCCCAGAACATTGCTACTTATTTATTAAAAAGCTAAAAACTAGTGAAAGCAAGTAACTGAACCAGTGAACTCTGGGTATCGATAGGTTCGTCTTAAATAGGCCACTTCCCCACTCCCCCACCCCCCCTTGCTTGGTCTTGTCCTTGGTGGCTAAGACTTAGCTCTGCAGGGGATGTTAAAGCACAGTTAGTAGGACGTGGCTCTGCACAGCCCAAAAACCAGCTTACTCCTTAGCCAGGGTGTGAGGCCTCGACTATATTCTTCAAAATGTACTTAGGCTCTGGTTACTGGGATGGCCAGTAGATGTAATGCAGATGGTTGGAGTTTGGGGAGGGTTAGGAGGCATCAAGCAGGACAAGGTGCTGCTGAGTTCAGAGGGCCCACGTTCAAGGGATGGAGGTGGAACCTGGAGACCGACTCTTAAAAGCACAGTCCGTGGTTGGGTGTGGTGGCTCATGCCTGTA