Transcript asmbl_35078

Sequence
Transcript Sequence for observation asmbl_35078 of TGE0057015:
CGTCCACATGCCGCGGCGGCGGCGAAAGGGGAGGCAGCGGCCGATAAATGCTATTAGAGCAGCCGCCGCGGAGCCGTCCCCGACGCCACCTCCTTTTCCTTCGCCGCAGTTTCCTCCGCCGCTGTCGGGCGTGCGGCGCTGAGGGACCCGGGCGAGCGCGCCGCGCACCGCCCCGCCGGCTCGCCTCCCTCGCCGCGTTCCGCCCTCAGTGGTCTGCCGGGCGCCCCCTCCTCCGGCCCGGGCGGGGCCTCTGATCGCCTCAAGAGAGCGGGGAGGGGGCTCGGGGGCCGCGGCCTGCCCTCCCGGCGGGCGGCTGAGGGCGAGGGAGGCCCTCCCTTCTGGCGAGGGGAGGGAGGGTGGGTCAGGAGCCCCCAACCCGCCCTGCGGAGCTCGGGGCCGCGCGAGGGGCGGTTGTCTGGGGGAGGGGGCGCGGGGTGATTCAGCGCCCGGCGAGGCGGAAGCGGCCGCAAGAGGAGGAGGGGAGAGCCCGTCCGCGCCTGGGCTCCCGGGGTGGCACGAGCCCGCGGCCGGAGTGCGAGGCGGAGGCGAGGAGGCCGCGGGGACGGGAGGCGAGGCCGGCCGGGCCCCCGAAGCCATGGAGAACGCGCACACCAAGACGGTGGAGGAGGTGCTGGGCCACTTCGGCGTCAACGAGAGTACGGGGCTGAGCCTGGAACAGGTCAAGAAGCTTAAGGAGAGATGGGGCTCCAACGAGTTACCGGCTGAAGAAGGAAAAACCTTGCTGGAACTTGTGATTGAGCAGTTTGAAGACTTGCTAGTTAGGATTTTATTACTGGCAGCATGTATATCTTTTGTTTTGGCTTGGTTTGAAGAAGGTGAAGAAACAATTACAGCCTTTGTAGAACCTTTTGTAATTTTACTCATATTAGTAGCCAATGCAATTGTGGGTGTATGGCAGGAAAGAAATGCTGAAAATGCCATCGAAGCCCTTAAGGAATATGAGCCTGAAATGGGCAAAGTGTATCGACAGGACAGAAAGAGTGTGCAGCGGATTAAAGCTAAAGACATAGTTCCTGGTGATATTGTAGAAATTGCTGTTGGTGACAAAGTTCCTGCTGATATAAGGTTAACTTCCATCAAATCTACCACACTAAGAGTTGACCAGTCAATTCTCACAGGTGAATCTGTCTCTGTCATCAAGCACACTGATCCCGTCCCTGACCCACGAGCTGTCAACCAAGATAAAAAGAACATGCTGTTTTCTGGTACAAACATTGCTGCTGGGAAAGCTATGGGAGTGGTGGTAGCAACTGGAGTTAACACCGAAATTGGCAAGATCCGGGATGAAATGGTGGCAACAGAACAGGAGAGAACACCCCTTCAGCAAAAACTAGATGAATTTGGGGAACAGCTTTCCAAAGTCATCTCCCTTATTTGCATTGCAGTCTGGATCATAAATATTGGGCACTTCAATGACCCGGTTCATGGAGGGTCCTGGATCAGAGGTGCTATTTACTACTTTAAAATTGCAGTGGCCCTGGCTGTAGCAGCCATTCCTGAAGGTCTGCCTGCAGTCATCACCACCTGCCTGGCTCTTGGAACTCGCAGAATGGCAAAGAAAAATGCCATTGTTCGAAGCCTCCCGTCTGTGGAAACCCTTGGTTGTACTTCTGTTATCTGCTCAGACAAGACTGGTACACTTACAACAAACCAGATGTCAGTCTGCAGGATGTTCATTCTGGACAGAGTGGAAGGTGATACTTGTTCCCTTAATGAGTTTACCATAACTGGATCAACTTATGCACCTATTGGAGAAGTGCATAAAGATGATAAACCAGTGAATTGTCACCAGTATGATGGTCTGGTAGAATTAGCAACAATTTGTGCTCTTTGTAATGACTCTGCTTTGGATTACAATGAGGCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTGCTCTCACTTGCCTAGTAGAGAAGATGAATGTATTTGATACCGAATTGAAGGGTCTTTCTAAAATAGAACGTGCAAATGCCTGCAACTCAGTCATTAAACAGCTGATGAAAAAGGAATTCACTCTAGAGTTTTCACGTGACAGAAAGTCAATGTCGGTTTACTGTACACCAAATAAACCAAGCAGGACATCAATGAGCAAGATGTTTGTGAAGGGTGCTCCTGAAGGTGTCATTGACAGGTGCACCCACATTCGAGTTGGAAGTACTAAGGTTCCTATGACCTCTGGAGTCAAACAGAAGATCATGTCTGTCATTCGAGAGTGGGGTAGTGGCAGCGACACACTGCGATGCCTGGCCCTGGCCACTCATGACAACCCACTGAGAAGAGAAGAAATGCACCTTGAGGACTCTGCCAACTTTATTAAATATGAGACCAATCTGACCTTCGTTGGCTGCGTGGGCATGCTGGATCCTCCGAGAATCGAGGTGGCCTCCTCCGTGAAGCTGTGCCGGCAAGCAGGCATCCGGGTCATCATGATCACTGGGGACAACAAGGGCACTGCTGTGGCCATCTGTCGCCGCATCGGCATCTTCGGGCAGGATGAGGACGTGACGTCAAAAGCTTTCACAGGCCGGGAGTTTGATGAACTCAACCCCTCCGCCCAGCGAGACGCCTGCCTGAACGCCCGCTGTTTTGCTCGAGTTGAACCCTCCCACAAGTCTAAAATCGTAGAATTTCTTCAGTCTTTTGATGAGATTACAGCTATGACTGGCGATGGCGTGAACGATGCTCCTGCTCTGAAGAAAGCCGAGATTGGCATTGCTATGGGCTCTGGCACTGCGGTGGCTAAAACCGCCTCTGAGATGGTCCTGGCGGATGACAACTTCTCCACCATTGTGGCTGCCGTTGAGGAGGGGCGGGCAATCTACAACAACATGAAACAGTTCATCCGCTACCTCATCTCGTCCAACGTCGGGGAAGTTGTCTGTATTTTCCTGACAGCAGCCCTTGGATTTCCCGAGGCTTTGATTCCTGTTCAGCTGCTCTGGGTCAATCTGGTGACAGATGGCCTGCCTGCCACTGCACTGGGGTTCAACCCTCCTGATCTGGACATCATGAATAAACCTCCCCGGAACCCAAAGGAACCATTGATCAGCGGGTGGCTCTTTTTCCGTTACTTGGCTATTGGCTGTGAGTACAATTTTTTTATATTACTGATTTTTAAACAAAATGTTTGTGAGCTGAAATTTTGTAAATTCATCCCTTAAAAGCGTGTTTTTTCTTCTATCCCCGTATAGGGTAGCAAAAGACAGAGATGCCCTCTTACAGTTCGATGAACTATACATCCAATTTACCAGAGTCCTTTCACAGTTAGTTCCAGTTTTAGCATCCTGCCCTTACTTGGGCTTTTCTGAATGAGC