Transcript asmbl_35077

Sequence
Transcript Sequence for observation asmbl_35077 of TGE0057014:
CGTCCACATGCCGCGGCGGCGGCGAAAGGGGAGGCAGCGGCCGATAAATGCTATTAGAGCAGCCGCCGCGGAGCCGTCCCCGACGCCACCTCCTTTTCCTTCGCCGCAGTTTCCTCCGCCGCTGTCGGGCGTGCGGCGCTGAGGGACCCGGGCGAGCGCGCCGCGCACCGCCCCGCCGGCTCGCCTCCCTCGCCGCGTTCCGCCCTCAGTGGTCTGCCGGGCGCCCCCTCCTCCGGCCCGGGCGGGGCCTCTGATCGCCTCAAGAGAGCGGGGAGGGGGCTCGGGGGCCGCGGCCTGCCCTCCCGGCGGGCGGCTGAGGGCGAGGGAGGCCCTCCCTTCTGGCGAGGGGAGGGAGGGTGGGTCAGGAGCCCCCAACCCGCCCTGCGGAGCTCGGGGCCGCGCGAGGGGCGGTTGTCTGGGGGAGGGGGCGCGGGGTGATTCAGCGCCCGGCGAGGCGGAAGCGGCCGCAAGAGGAGGAGGGGAGAGCCCGTCCGCGCCTGGGCTCCCGGGGTGGCACGAGCCCGCGGCCGGAGTGCGAGGCGGAGGCGAGGAGGCCGCGGGGACGGGAGGCGAGGCCGGCCGGGCCCCCGAAGCCATGGAGAACGCGCACACCAAGACGGTGGAGGAGGTGCTGGGCCACTTCGGCGTCAACGAGAGTACGGGGCTGAGCCTGGAACAGGTCAAGAAGCTTAAGGAGAGATGGGGCTCCAACGAGTTACCGGCTGAAGAAGGAAAAACCTTGCTGGAACTTGTGATTGAGCAGTTTGAAGACTTGCTAGTTAGGATTTTATTACTGGCAGCATGTATATCTTTTGTTTTGGCTTGGTTTGAAGAAGGTGAAGAAACAATTACAGCCTTTGTAGAACCTTTTGTAATTTTACTCATATTAGTAGCCAATGCAATTGTGGGTGTATGGCAGGAAAGAAATGCTGAAAATGCCATCGAAGCCCTTAAGGAATATGAGCCTGAAATGGGCAAAGTGTATCGACAGGACAGAAAGAGTGTGCAGCGGATTAAAGCTAAAGACATAGTTCCTGGTGATATTGTAGAAATTGCTGTTGGTGACAAAGTTCCTGCTGATATAAGGTTAACTTCCATCAAATCTACCACACTAAGAGTTGACCAGTCAATTCTCACAGGTGAATCTGTCTCTGTCATCAAGCACACTGATCCCGTCCCTGACCCACGAGCTGTCAACCAAGATAAAAAGAACATGCTGTTTTCTGGTACAAACATTGCTGCTGGGAAAGCTATGGGAGTGGTGGTAGCAACTGGAGTTAACACCGAAATTGGCAAGATCCGGGATGAAATGGTGGCAACAGAACAGGAGAGAACACCCCTTCAGCAAAAACTAGATGAATTTGGGGAACAGCTTTCCAAAGTCATCTCCCTTATTTGCATTGCAGTCTGGATCATAAATATTGGGCACTTCAATGACCCGGTTCATGGAGGGTCCTGGATCAGAGGTGCTATTTACTACTTTAAAATTGCAGTGGCCCTGGCTGTAGCAGCCATTCCTGAAGGTCTGCCTGCAGTCATCACCACCTGCCTGGCTCTTGGAACTCGCAGAATGGCAAAGAAAAATGCCATTGTTCGAAGCCTCCCGTCTGTGGAAACCCTTGGTTGTACTTCTGTTATCTGCTCAGACAAGACTGGTACACTTACAACAAACCAGATGTCAGTCTGCAGGATGTTCATTCTGGACAGAGTGGAAGGTGATACTTGTTCCCTTAATGAGTTTACCATAACTGGATCAACTTATGCACCTATTGGAGAAGTGCATAAAGATGATAAACCAGTGAATTGTCACCAGTATGATGGTCTGGTAGAATTAGCAACAATTTGTGCTCTTTGTAATGACTCTGCTTTGGATTACAATGAGGCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTGCTCTCACTTGCCTAGTAGAGAAGATGAATGTATTTGATACCGAATTGAAGGGTCTTTCTAAAATAGAACGTGCAAATGCCTGCAACTCAGTCATTAAACAGCTGATGAAAAAGGAATTCACTCTAGAGTTTTCACGTGACAGAAAGTCAATGTCGGTTTACTGTACACCAAATAAACCAAGCAGGACATCAATGAGCAAGATGTTTGTGAAGGGTGCTCCTGAAGGTGTCATTGACAGGTGCACCCACATTCGAGTTGGAAGTACTAAGGTTCCTATGACCTCTGGAGTCAAACAGAAGATCATGTCTGTCATTCGAGAGTGGGGTAGTGGCAGCGACACACTGCGATGCCTGGCCCTGGCCACTCATGACAACCCACTGAGAAGAGAAGAAATGCACCTTGAGGACTCTGCCAACTTTATTAAATATGAGACCAATCTGACCTTCGTTGGCTGCGTGGGCATGCTGGATCCTCCGAGAATCGAGGTGGCCTCCTCCGTGAAGCTGTGCCGGCAAGCAGGCATCCGGGTCATCATGATCACTGGGGACAACAAGGGCACTGCTGTGGCCATCTGTCGCCGCATCGGCATCTTCGGGCAGGATGAGGACGTGACGTCAAAAGCTTTCACAGGCCGGGAGTTTGATGAACTCAACCCCTCCGCCCAGCGAGACGCCTGCCTGAACGCCCGCTGTTTTGCTCGAGTTGAACCCTCCCACAAGTCTAAAATCGTAGAATTTCTTCAGTCTTTTGATGAGATTACAGCTATGACTGGCGATGGCGTGAACGATGCTCCTGCTCTGAAGAAAGCCGAGATTGGCATTGCTATGGGCTCTGGCACTGCGGTGGCTAAAACCGCCTCTGAGATGGTCCTGGCGGATGACAACTTCTCCACCATTGTGGCTGCCGTTGAGGAGGGGCGGGCAATCTACAACAACATGAAACAGTTCATCCGCTACCTCATCTCGTCCAACGTCGGGGAAGTTGTCTGTATTTTCCTGACAGCAGCCCTTGGATTTCCCGAGGCTTTGATTCCTGTTCAGCTGCTCTGGGTCAATCTGGTGACAGATGGCCTGCCTGCCACTGCACTGGGGTTCAACCCTCCTGATCTGGACATCATGAATAAACCTCCCCGGAACCCAAAGGAACCATTGATCAGCGGGTGGCTCTTTTTCCGTTACTTGGCTATTGGCTGTTACGTCGGCGCTGCTACCGTGGGTGCTGCTGCATGGTGGTTCATTGCTGCTGACGGTGGTCCAAGAGTGTCCTTCTACCAGCTGAGTCATTTCCTACAGTGTAAAGAGGACAACCCGGACTTTGAAGGCGTGGATTGTGCAATCTTTGAATCCCCATACCCGATGACAATGGCGCTCTCTGTTCTAGTAACTATAGAAATGTGTAACGCCCTCAACAGCTTGTCCGAAAACCAGTCCTTGCTGAGGATGCCCCCCTGGGAGAACATCTGGCTCGTGGGCTCCATCTGCCTGTCCATGTCACTCCACTTCCTGATCCTCTATGTCGAACCCTTGCCACTCATCTTCCAGATCACACCGCTGAACGTGACCCAGTGGCTGATGGTGCTGAAAATCTCCTTGCCCGTGATTCTCATGGATGAGACGCTCAAGTTTGTGGCCCGCAACTACCTGGAACCTGCAATACTGGAGTAACCGCTTCCTAAACCATTTTGCAGAAATGTAAGGGTGTTCGGTTGCGTGCATGTGCGTTTTTAGCAACACATCTACCAACCCTGTGCATGACTGATGTTGGGGAAAAAGAAAAGTAAAAAACTTCCCAACTCACTTTGTGTTATGTGGAGGAAATGTGTATTACCAATGGGGTTGTTAGCTTTTAAATCAAAATACTGATTACAGATGTACAATTTAGCTTAATCAGAAAGCCTCTCCAGAGAAGTTTGGTTTCTTTGCTGCAAGAGGAATGAGGCTCTGTAACCTTATCTAAGAACTTGGAAGCCGTCAGCCAAGTCGCCACATTTCTCTGCAAAATGTCATAGCTTATATAAATGTACAGTATTCAATTGTAATGCATGCCTTCGGTTGTAAGTAGCCAGATCCCTCTCCAGTGACATTGGAACATGCTACTTTTTAATTGGCCCTGTACAGTTTGCTTATTTATAAATTCATTAAAAACACTACAGGTGTTGAATGGTTAAAATGTAGGCCTCCAGTTCATTTTCAGTTATTTTCTGAGTGTGCAGACAGCTATTTCGCACTGTATTAAATGTAACTTATTTAATGAAATCAGAAGCAGTAGACAGATGTTGGTGCAATACAAATATTGTGATGCATTTATCTTAATAAAATGCTAAATGTCAATTTATCACTGCGCATGTTTGACTTTAGACTGTAAATAGAGATCAGTTTGTTTCTTTCTGTGCTGGTAACAATGAGCGTCGCACAGACATGGTTTCAGGTAAATAAATCTATTC