Transcript asmbl_34730

Sequence
Transcript Sequence for observation asmbl_34730 of TGE0056781:
GGGTGACGTCATCGGGACGTACTAAGACTAGGGTTGGGCCGAGAGTCGGAGCCATTACTGCAGGAAAAGGTCCCGGAGAGCTGAGCAGTCAAGATGTGTGACTTCACCGAAGACCAGACCGCAGGTAGGTTATCTCTGATCCCTACCGAGGTCACCCTTAGGGAGAGGGACACCCTCCCCCCAGCACCTATCCTCTAATCTTAATCTGTCATCTCTTTAGCACCCCCATGAGATTACCCCCTGGATTATTTTCTCTTCTTCTGGATCCTCCATTTTCTTTTCTCACTTTCTTCCTCCCTCCCCTTCCACTCTAGATCTGATCCCAAGCACTGGGTGAGTTTTAGGTGGTGTGGGTATGTGAAAAAACTTGGTCACTTAATGCCTGCTGTGTGTGGGGTCTCGGGAGGGTGTATAAAGCTGCCTGCTTTCCTTTGTCCTTTAATCAGCTACTTCTGCCTCTTTTCTCCTCTTGTGATAACTGTCCCCGCCCTCCCAGCTTGCAGTTGTGAAGATTGTAGAGCAGTGACCTGATATTCTGTGCAGATGGGGACAAGACAGGGGAGTTTGCTAAGGATATGACTGTAGCTATACCCTCTGGAAGTTCTCTTTATACTGGAGGGGTGCGAAGTGGCAGGTTGGGATGACCCTAGTCCCAGGCTGCTGCTCCCACTTCCTTATAAGGACAGGACTGAGACTGGGCGGTGGCGAATTCCTGCCCTGAGAAGTGTAGTAGCAGCAGTGGAGATTGGCAGGCCTGCCGCAGGCAGAGGGGTTGTGTAAATGGATGTTACCAGGCTGCCAGAAGGGGAGGAAGCCTCTATATAGAACACTTGAGTTGGGAGGAAGAGAAATAGAGCCCTCTTAAGTAGACTTTGGTGTACAGTTTGGTGCAGATATCTCGTTTCCTCAGCATGATCAAAGTTGAATGGGCAGCAGAGCTCTGAGGTAGGGTTTGGATTAACCCTCAAATCCTGTGTTGACATTCATCTGAATCCTCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGCGTTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAAGTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGCATTCACCAAATAAACTTGCTCTCTGGGCCCTCGGTTCGGTTCTTTCTTTCCTGAACAGGGTAAAGGGGAAGAAGGTGAGATGGTGATGATTTCTGCCCTGAGGCAGAGTCCAAGGTCAATCAATGGTGCAGGGGTTGAGGAAAGCTGGGGGAGGCCCTGTACTAGCCATCTGGGCTTCATTTAAAAACTACTGGCCCCATTCATCCATCTTACACAAGCTACCTCTTGGGAGATTAGGAAAGCCATAGATCCCAGTAGGACTAAGGCTGGCCATCCCTGTTCCATTCCATATCAGGCTGTCTTCTCCTACCCTTCCAGCTCCTTAAATCTGGCCCCCGCCCTCCCAAGCTCCCAATAAGGCCTTTTGTGGGGAAGCCTGTGGAGTGTTTATTGGAGCTAAAGCCAGGCCATTATTAGCACTGCCTAAGCCTGTCCGTCACCTCAGCAGGGTGAAGGGCCAATTATAACAAAAGTAGGTAAGGGGCTTGCCTCCTCTCTAATAAGGGAAGGAGTGAAACCAC