Transcript asmbl_34726

Sequence
Transcript Sequence for observation asmbl_34726 of TGE0000265:
GGGTGACGTCATCGGGACGTACTAAGACTAGGGTTGGGCCGAGAGTCGGAGCCATTACTGCAGGAAAAGGTCCCGGAGAGCTGAGCAGTCAAGATGTGTGACTTCACCGAAGACCAGACCGCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAAGTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGCATTCACCAAATAAACTTGCTCTCTGGGCCCTCGGTTCGGTTCTTTCTTTCCTGAACAGGGTAAAGGGGAAGAAGGTGAGATGGTGATGATTTCTGCCCTGAGGCAGAGTCCAAGGTCAATCAATGGTGCAGGGGTTGAGGAAAGCTGGGGGAGGCCCTGTACTAGCCATCTGGGCTTCATTTAAAAACTACTGGCCCCATTCATCCATCTTACACAAGCTACCTCTTGGGAGATTAGGAAAGCCATAGATCCCAGTAGGACTAAGGCTGGCCATCCCTGTTCCATTCCATATCAGGCTGTCTTCTCCTACCCTTCCAGCTCCTTAAATCTGGCCCCCGCCCTCCCAAGCTCCCAATAAGGCCTTTTGTGGGGAAGCCTGTGGAGTGTTTATTGGAGCTAAAGCCAGGCCATTATTAGCACTGCCTAAGCCTGTCCGTCACCTCAGCAGGGTGAAGGGCCAATTATAACAAAAGTAGGTAAGGGGCTTGCCTCCTCTCTAATAAGGGAAGGAGTGAAACCAC