Transcript asmbl_33931

Sequence
Transcript Sequence for observation asmbl_33931 of TGE0000197:
GCGTCCTCGTGGAAGGTTCGTGTGCTAGTTAGATGGGCGCCAGGGGTCGCCGGCGGGAAGCATGGAGGGGTCTTTGGGGGCCTTTGGGAACATGGAGTCCTATTCTGTTCCGCCTGGGGCCTCGGTGGCGGCTTGCACGCCCCGAGATGACGGCCGCTGCCCTAGGCAGGGCCGGCGGGCGATTGCGCGTGTCCTGCTCCTCTTAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCAGGCCTGAGCTCCCTGTCTCTCCTCAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGCACCGCCGTGATGCCCAGGGAAGACAGGGCGACCTGGAAGTCCAACTACTTCCTTAAGATCATCCAACTATTGGATGATTATCCGAAATGTTTCATTGTGGGAGCAGACAATGTGGGCTCCAAGCAGATGCAGCAGATCCGCATGTCCCTTCGCGGGAAGGCTGTGGTGCTGATGGGCAAGAACACCATGATGCGCAAGGCCATCCGAGGGCACCTGGAAAACAACCCAGCTCTGGAGAAACTGCTGCCTCATATCCGGGGGAATGTGGGCTTTGTGTTCACCAAGGAGGACCTCACTGAGATCAGGGACATGTTGCTGGCCAATAAGGTGCCAGCTGCTGCCCGTGCTGGTGCCATTGCCCCATGTGAAGTCACTGTGCCAGCCCAGAACACTGGTCTCGGGCCCGAGAAGACCTCCTTTTTCCAGGCTTTAGGTATCACCACTAAAATCTCCAGGGGCACCATTGAAATCCTGAGTGATGTGCAGCTGATCAAGACTGGAGACAAAGTGGGAGCCAGCGAAGCCACGCTGCTGAACATGCTCAACATCTCCCCCTTCTCCTTTGGGCTGGTCATCCAGCAGGTGTTCGACAATGGCAGCATCTACAACCCTGAAGTGCTTGATATCACAGAGGAAACTCTGCATTCTCGCTTCCTGGAGGGTGTCCGCAATGTTGCCAGTGTCTGTCTGCAGATTGGCTACCCAACTGTTGCATCAGTACCCCATTCTATCATCAACGGGTACAAACGAGTCCTGGCCTTGTCTGTGGAGACGGATTACACCTTCCCACTTGCTGAAAAGGTCAAGGCCTTCTTGGCTGATCCATCTGCCTTTGTGGCTGCTGCCCCTGTGGCTGCTGCCACCACAGCTGCTCCTGCTGCTGCTGCAGCCCCAGCTAAGGTTGAAGCCAAGGAAGAGTCGGAGGAGTCGGACGAGGATATGGGATTTGGTCTCTTTGACTAATCACCAAAAAGCAACCAACTTAGCCAGTTTTATTTGCAAAACAAGGAAATAAAGGCTTACTTCTTTAA