Transcript asmbl_33700

Sequence
Transcript Sequence for observation asmbl_33700 of TGE0056186:
GACTGATTGCTTGGAACAAATGGAATAAATCGTCTTGTCAATAAAGTGATGGTCAATTGAGTCATTTGTGTGCAAAATATTGTGCAAGGCCCGGGTACAGAACAAGGAATAATAAGACACGCCCTGAAGGAGTACATCGTCTAGTGAGGGACAGACCAAGCACGCAAAACAAATTGCAATATAATGTGATAAGTTCTTTAAAAGAGGTAAGAGCAACGTGCTTTGGGAGCAGAGAAGAGGGAGAAAGCAGCATCTTGCCTGGATGAGCCAGGGGACACAGAAGAGAAGCCCACTATCTCATTTAATCTTTACAACTCTCTTGCAAGGTTCCCTGGTTGTGAAAATACATGAGATAAATCATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTTAGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAGCTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAATGAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAACTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAGAAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCTCCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGCCTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTTGACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAGCTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCATAACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAAAAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAGCCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAATTCTCAAGAAAGCCCTCATTTTTATAACCTGGCAAAATCTTGTTAATGTCATTGCTAAAAAATAAATAAAAGCTAGATACTGGAAACCTAACTGCAATGTGGATGTTTTACCCACATGACTTATTATGCATAAAGCCAAATTTCCAGTTTAAGTAATTGCCTACAATAAAAAGAAATTTTGCCTGCCATTTTCAGAATCATCTTTTGAAGCTTTCTGTTGATGTTAACTGAGCTACTAGAGATATTCTTATTTCACTAAATGTAAAATTTGGAGTAAATATATATGTCAATATTTAGTAAAGCTTTTCTTTTTTAATTTCCAGGAAAAAATAAAAAGAGTATGAGTCTTCTGTAATTCATTGAGCAGTTAGCTCATTTGAGATAAAGTCAAATGCCAAACACTAGCTCTGTATTAATCCCCATCATTACTGGTAAAGCCTCATTTGAATGTGTGAATTCAATACAGGCTATGTAAAATTTTTACTAATGTCATTATTTTGAAAAAATAAATTTAAAAATACATTCAAAATTACTATTGTATACAAGCTTAATTGTTAATATTCCCTAAACACAATTTTATGAAGGGAGAAGACATTGGTTTGTTGACAATAACAGTACATCTTTTCAAGTTCTCAGCTATTTCTTCTACCTCTCCCTATCTTACATTTGAGTATGGTAACTTATGTCATCTATGTTGAATGTAAGCTTATAAAGCACAAAGCATACATTTCCTGACTGGTCTAGAGAACTGATGTTTCAATTTACCCCTCTGCTAAATAAATATTAAAACTATCATGTGACTTCATGTAATCAGGCTGAACATTTCTACAATTACTAGATGTATTAGACGTAAGTATTTTCTTTAGTTAAACCACCCATGTTAGAAATGTTTTCTGTAGAATTTATAAACAACTATCAATGCAGACAATTTAATAAGCCTGGGGATGATTTACTTACAGTAAACATTTATCAAATTGTACATTTGTGCTATCAACAATTAATAAGCAAATATGTGAAAATAGTTTCTGTCTTCTATGAAGTTAGATATTTGATGGTTAAAACCCCTATAAATCATAGTTTCATATGGGAAAAAATAATTGAAATACAGTGTAAATTTAAATAATTTATTAAGTATAGCAAATAATTGAAATATGGTGGACTAAATTTTGTCATAGAAATATGTGCAAGTTATAGTAGTGGCTCACATGAGAGGTAATCAATTCTGCTAATAGTAGCAGAATGAGTGCAGTGGAACATGAAAAACTTGAGGAGATAACAGTTGAGGTGGGTTTCCATAGATGCATAATAGTTCAAGAGCAAGATTTGGTGGGGAGGCACTATTCAAGACAGGGACTAAGTTCAAAATCCAAGACGTATGCTGGGACACACCTCTGACAGGTTGGCATAAAGGAGGCTTAATCAAACTATTTTTCTTCTTCTGAAACAGAAGCAATAATTTTCATTTACATTTGACATATCCCGAGGTAATATTAACATTAGGGAAAGTTACTCTTTTCCATCTTTCCACATTCTTGCAGGACCATAAAATCTGAATTTTCCAGTATTTTTAATAAGAGGGAAGAAACCTCTCTTTTTCTTCTCTTTTTCATCTCCCAAGAGATCCTCCTCTCATGACTACAGTTGAATAGGTGGTTTCTATTGGAAGACATTCAGGAATTCAAGGTGCATGTCCATAAATGGACTTTTTTTGTTGTTGTTCAGAGCTGGACCTTGAATGATGCATCCTTCTCTCTGTTGTAACCATGAATAATGCACCCTTCATGCTATAGCCTTTAACGATTCACCCTTCTTATTGTAACCTTGAATGATTCACCCTTTATGGTGTAGCCTTGAGTGACGCACCCTTCATGTTGTAGCCTTCAATGATGCACACTCCATGTTATAGCCTTGAATGATATACCCTTTATGCTGCAGCCTTTCTCTTATGGGGAAAAGCCTGCAGATATCCTGCTGCTTAACTGACAAGTGTGGTGAGAAATAAGTAGAAATCTAAAGAGGGGAAGACCATTTTGGACACTTATCTGCAAGGCAGATCCAACACACTTTTCCAGTAGTCAAGCTACTTCTAATTTTGTTCAGTATCAAAATGAGAAACAGGCCTGATTCTCCAGCACTCTTGTCAACACAACTTCCCCCCATATTTATATATATACACACACATATAT