Transcript asmbl_33698

Sequence
Transcript Sequence for observation asmbl_33698 of TGE0056186:
GGCTGCCAAAACAAAAGTCTTCTCTTAAAGGGATACTCAGTAACTGAATGAGAGTGGGCTGCTAGAAGAAGCTTAATGTTGAACTTAAAGTGGCAGTGTGAATAATAATCTTTATGATATTTTGTTAAATGAAAAGCCACAAGCCTGTATTCAACATGTGCTGCCTTAGACACATATCAGTAGTAAATATAAACTAAGAACAAACATGTAAGAAACTGAAAAACATTTGTTTCTTCTCTAGAGAATCTAGGCAAAAATTCCCAGAAGATACCTTAAGGTTCCCTGGTTGTGAAAATACATGAGATAAATCATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTTAGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAGCTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAATGAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAACTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAGAAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCTCCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGCCTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTTGACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAGCTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCATAACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAAAAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAGCCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAATTCTCAAGAAAGCCCTCATTTTTATAACCTGGCAAAATCTTGTTAATGTCATTGCTAAAAAATAAATAAAAGCTAGATACTGGAAACCTAACTGCAATGTGGATGTTTTACCCACATGACTTATTATGCATAAAGCCAAATTTCCAGTTTAAGTAATTGCCTACAATAAAAAGAAATTTTGCCTGCCATTTTCAGAATCATCTTTTGAAGCTTTCTGTTGATGTTAACTGAGCTACTAGAGATATTCTTATTTCACTAAATGTAAAATTTGGAGTAAATATATATGTCAATATTTAGTAAAGCTTTTCTTTTTTAATTTCCAGGAAAAAATAAAAAGAGTATGAGTCTTCTGTAATTCATTGAGCAGTTAGCTCATTTGAGATAAAGTCAAATGCCAAACACTAGCTCTGTATTAATCCCCATCATTACTGGTAAAGCCTCATTTGAATGTGTGAATTCAATACAGGCTATGTAAAATTTTTACTAATGTCATTATTTTGAAAAAATAAATTTAAAAATACATTCAAAATTACTATTGTATACAAGCTTAATTGTTAATATTCCCTAAACACAATTTTATGAAGGGAGAAGACATTGGTTTGTTGACAATAACAGTACATCTTTTCAAGTTCTCAGCTATTTCTTCTACCTCTCCCTATCTTACATTTGAGTATGGTAACTTATGTCATCTATGTTGAATGTAAGCTTATAAAGCACAAAGCATACATTTCCTGACTGGTCTAGAGAACTGATGTTTCAATTTACCCCTCTGCTAAATAAATATTAAAACTATCATGTGACTTCATGTAATCAGGCTGAACATTTCTACAATTACTAGATGTATTAGACGTAAGTATTTTCTTTAGTTAAACCACCCATGTTAGAAATGTTTTCTGTAGAATTTATAAACAACTATCAATGCAGACAATTTAATAAGCCTGGGGATGATTTACTTACAGTAAACATTTATCAAATTGTACATTTGTGCTATCAACAATTAATAAGCAAATATGTGAAAATAGTTTCTGTCTTCTATGAAGTTAGATATTTGATGGTTAAAACCCCTATAAATCATAGTTTCATATGGGAAAAAATAATTGAAATACAGTGTAAATTTAAATAATTTATTAAGTATAGCAAATAATTGAAATATGGTGGACTAAATTTTGTCATAGAAATATGTGCAAGTTATAGTAGTGGCTCACATGAGAGGTAATCAATTCTGCTAATAGTAGCAGAATGAGTGCAGTGGAACATGAAAAACTTGAGGAGATAACAGTTGAGGTGGGTTTCCATAGATGCATAATAGTTCAAGAGCAAGATTTGGTGGGGAGGCACTATTCAAGACAGGGACTAAGTTCAAAATCCAAGACGTATGCTGGGACACACCTCTGACAGGTTGGCATAAAGGAGGCTTAATCAAACTATTTTTCTTCTTCTGAAACAGAAGCAATAATTTTCATTTACATTTGACATATCCCGAGGTAATATTAACATTAGGGAAAGTTACTCTTTTCCATCTTTCCACATTCTTGCAGGACCATAAAATCTGAATTTTCCAGTATTTTTAATAAGAGGGAAGAAACCTCTCTTTTTCTTCTCTTTTTCATCTCCCAAGAGATCCTCCTCTCATGACTACAGTTGAATAGGTGGTTTCTATTGGAAGACATTCAGGAATTCAAGGTGCATGTCCATAAATGGACTTTTTTTGTTGTTGTTCAGAGCTGGACCTTGAATGATGCATCCTTCTCTCTGTTGTAACCATGAATAATGCACCCTTCATGCTATAGCCTTTAACGATTCACCCTTCTTATTGTAACCTTGAATGATTCACCCTTTATGGTGTAGCCTTGAGTGACGCACCCTTCATGTTGTAGCCTTCAATGATGCACACTCCATGTTATAGCCTTGAATGATATACCCTTTATGCTGCAGCCTTTCTCTTATGGGGAAAAGCCTGCAGATATCCTGCTGCTTAACTGACAAGTGTGGTGAGAAATAAGTAGAAATCTAAAGAGGGGAAGACCATTTTGGACACTTATCTGCAAGGCAGATCCAACACACTTTTCCAGTAGTCAAGCTACTTCTAATTTTGTTCAGTATCAAAATGAGAAACAGGCCTGATTCTCCAGCACTCTTGTCAACACAACTTCCCCCCATATTTATATATATACACACACATATAT