Transcript asmbl_33696

Sequence
Transcript Sequence for observation asmbl_33696 of TGE0056185:
TGTAAAGAGGCTTGTAAGAAAAATGTTCTCACAGTGAGCTTCCTTATTTGAAGCAGGACTCAATTCTTGGTTAAAAGCTATGGTATTTGAGCTAGTTAAACACATATCTCTCTCCCATTCCATAGGGAATGAGCTGGGCTGTCCTTTCTCCCCACGTTCACCTGCACTTCGTTAGAGAGCAGTGTTCACATGCCACACCACAAGATCCCCACAATGACATAACTCCATTCAGAGACTGGCGTGACTGGGCTGGGTCTCCCCACCCCCCTTCAGCTCTTGTATCACTCAGAATCTGGCAGCCAGTTCCGTCCTGACAGAGTTCACAGCATATATTGGTGGATTCTTGTCCATAGTGCATCTGCTTTAAGAATTAACGAAAGCAGTGTCAAGACAGTAAGGATTCAAACCATTTGCCAAAAATGAGTCTAAGTGCATTTACTCTCTTCCTGGCATTGATTGGTGGTACCAGTGGCCAGTACTATGATTATGATTTTCCCCTATCAATTTATGGGCAATCATCACCAAACTGTGCACCAGAATGTAACTGCCCTGAAAGCTACCCAAGTGCCATGTACTGTGATGAGCTGAAATTGAAAAGTGTACCAATGGTGCCTCCTGGAATCAAGTATCTTTACCTTAGGAATAACCAGATTGACCATATTGATGAAAAGGCCTTTGAGAATGTAACTGATCTGCAGTGGCTCATTCTAGATCACAACCTTCTAGAAAACTCCAAGATAAAAGGGAGAGTTTTCTCTAAATTGAAACAACTGAAGAAGCTGCATATAAACCACAACAACCTGACAGAGTCTGTGGGCCCACTTCCCAAATCTCTGGAGGATCTGCAGCTTACTCATAACAAGATCACAAAGCTGGGCTCTTTTGAAGGATTGGTAAACCTGACCTTCATCCATCTCCAGCACAATCGGCTGAAAGAGGATGCTGTTTCAGCTGCTTTTAAAGGTCTTAAATCACTCGAATACCTTGACTTGAGCTTCAATCAGATAGCCAGACTGCCTTCTGGTCTCCCTGTCTCTCTTCTAACTCTCTACTTAGACAACAATAAGATCAGCAACATCCCTGATGAGTATTTCAAGCGTTTTAATGCATTGCAGTATCTGCGTTTATCTCACAACGAACTGGCTGATAGTGGAATACCTGGAAATTCTTTCAATGTGTCATCCCTGGTTGAGCTGGATCTGTCCTATAACAAGCTTAAAAACATACCAACTGTCAATGAAAACCTTGAAAACTATTACCTGGAGGTCAATCAACTTGAGAAGTTTGACATAAAGAGCTTCTGCAAGATCCTGGGGCCATTATCCTACTCCAAGATCAAGCATTTGCGTTTGGATGGCAATCGCATCTCAGAAACCAGTCTTCCACCGGATATGTATGAATGTCTACGTGTTGCTAACGAAGTCACTCTTAATTAATATCTGTATCCTGGAACAATATTTTATGGTTATGTTTTTCTGTGTGTCAGTTTTCATAGTATCCATATTTTATTACTGTTTATTACTTCCATGAATTTTAAAATCTGAGGGAAATGTTTTGTAAACATTTATTTTTTTTAAAGAAAAGATGAAAGGCAGGCCTATTTCATCACAAGAACACACACATATACACGAATAGACATCAAACTCAATGCTTTATTTGTAAATTTAGTGTTTTTTTATTTCTACTGTCAAATGATGTGCAAAACCTTTTACTGGTTGCATGGAAATCAGCCAAGTTTTATAATCCTTAAATCTTAATGTTCCTCAAAGCTTGGATTAAATACATATGGATGTTACTCTCTTGCACCAAATTATCTTGATACATTCAAATTTGTCTGGTTAAAAAATAGGTGGTAGATATTGAGGCCAAGAATATTGCAAAATACATGAAGCTTCATGCACTTAAAGAAGTATTTTTAGAATAAGAATTTGCATACTTACCTAGTGAAACTTTTCTAGAATTATTTTTCACTCTAAGTCATGTATGTTTCTCTTTGATTATTTGCATGTTATGTTTAATAAGCTACTAGCAAAATAAAACATAGCAAATGGCATCACTGTGTTTGACTTCTTGTGAAATTTCTGTACTTTGTATATAAAATACATAAAACAATAGATTAGAAATCAAAAGATATCTCTGGCCTGCAATATTTTACTGATGTGAACATAGGATTTTCCACTAAATAATTTGTCTACTTCTAGCATTCACTTACAAAGAGTTCTTAAAAACACCTATAATAGGTACTTAGATTTCACAACTTACTTAGATATTTGTCATTATTCCCATTCCTGGTGTTTTTACTGGTTCATATACAATGGTATTCTATTAGATAAGAAGCTGCTATGTGATCTCAGCACTCACTCCTTGGTTGTCAAGAAATGGTGGATAACTCACAGGATTAAAAATGAATGAATATAAAATTTTCTGAAATAGATATTTAAAAAATCATTTTAGCTTGAAGCCAATATGTCTGGATCATAGGTTTTGAGTTCATAATCCAGTAATAACAGCTTTCAGCTTTCTATGAGTATATACAATTCTATACAATGATAAATACTCTGCATATAATTTATAAAAATAACTTCTGTTTTACCTAGTTAACAATAAAACCTATGTGTGGAGCCAAATGTTATGCAGACAAAGGTCTGCTCATCCCATACCAGTGTATATATAGTCAAATATGTGTCTAGTACAAATAAAATGTATCTCTAAGGCATAAAATGTTTTAACACACCACTTTTAGTGAACTCTATCTTATGGTACAGCGGCCTTTCATCAGAGGATCATCATTGAGACTGAGTTGACTGGCAGATATGTGCGATGGATATTACATTAGGTACAATGTGTATTTTTGATTTTCATGAGTTTTCTACATTAAGGTAAATTCCTTAGAGTGTGATAGCAGCCTCAGTTTATTTGTTGGTTTAAACTTGAAATCTACTTTTTCTCGATAAAACTATAATGTAGATGAATTGAAAATGAATTTTCTTTTCCCTGTCTACAAAAGTCACTATCAAGCCTTGGAAACCTATTCTCAAATAGAGGGTAGATAATGTGCCATAAATTCTCTTTTAGAAAGAATGTGATGGAATTAAATGAGC