Transcript asmbl_33511

Sequence
Transcript Sequence for observation asmbl_33511 of TGE0057008:
GACGCCCTCTAACCTCACACTGTCCAATAAAAAAAGGAGTTTCAGATTAGCACCAGTTTTGACCAATGGATGAGAAGATCAGCGTGTATTAACCTGTAGAAGCAGCACAGAGAATGATGAGCAGCCAGTTCACCCAATGGACCTGCCTACTGCAGCGTAGGCCTCGCCTCAACGGCAGGAGAGCAGGCGGCTGCGGTTGCTGCAGCCTTCAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGCCTCCGGGGCCTTGCGGAGACTCACCCCTTCAGCGTCGCTGCCCCCAGCTCAGCTCTTACTGCGGGCCGCTCCGACGGCGGTCCATCCTGTCAGGGACTATGCGGCGCAAACATCTCCTTCGCCAAAAGCAGGCGCCGCCACCGGGCGCATCGTGGCGGTCATTGGCGCAGTGGTGGACGTCCAGTTTGATGAGGGACTACCACCAATTCTAAATGCCCTGGAAGTGCAAGGCAGGGAGACCAGACTGGTTTTGGAGGTGGCCCAGCATTTGGGTGAGAGCACAGTAAGGACTATTGCTATGGATGGTACAGAAGGCTTGGTTAGAGGCCAGAAAGTACTGGATTCTGGTGCACCAATCAAAATTCCTGTTGGTCCTGAGACTTTGGGCAGAATCATGAATGTCATTGGAGAACCTATTGATGAAAGAGGTCCCATCAAAACCAAACAATTTGCTCCCATTCATGCTGAGGCTCCAGAGTTCATGGAAATGAGTGTTGAGCAGGAAATTCTGGTGACTGGTATCAAGGTTGTCGATCTGCTAGCTCCCTATGCCAAGGGTGGCAAAATTGGGCTTTTTGGTGGTGCTGGAGTTGGCAAGACTGTACTGATCATGGAGTTAATCAACAATGTCGCCAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAGAGGACCCGTGAAGGCAATGATTTATACCATGAAATGATTGAATCTGGTGTTATCAACTTAAAAGATGCCACCTCTAAGGTAAGCATTGAGCTAATTGATGTCCACGTGGTAGTTACGCCAGGAAACTATTGCCAACTGAAGCCATGTTCTATATTTTCTATTTAATTTTTTTTTCTTTTTAAGAAAATGTTAATATTTTCATTTTCGTGTCCCAGGGCCTACAAAGGAAACCTGTTAGTGTTTTCCCCCCCAACTTCCAATACACAAATGGACATTTTCTTTCCTCTTTGATACTGACATTAAATAACATTTCCAGGTTTTCTTTTTGGTAGATAGTCCCATCATTTGAAAGCTAATTTTGGGAGGGCTGGATTGGACGTGGTACATATGTTTCAGTTAAGCCTATTTTGTACTTTTCACTTAACTTGAATAGGTTTTTATTTCCTTTCTACTATAGTTTTGCCTTACTAATATAAGAAGCTGTCTTTTTTTTTTGAACTGCATCTCTAATAGGGAAAAGAAACTTGCACACAAAAACGCTGACACCTTCTGAGAAAGGATCTGTGGTCGTTTCTCCGATTTGGGAACCTTCAGTATGTGGCTTCTCTACTCCTTTGTCAGGTTTTACGATTATGTATGATTACTGCAGGTAGCGCTGGTATATGGTCAAATGAATGAACCACCTGGTGCTCGTGCCCGGGTAGCTCTGACTGGGCTGACTGTGGCTGAATACTTCAGAGACCAAGAAGGTCAAGATGTACTGCTATTTATTGATAACATCTTTCGCTTCACCCAGGCTGGTTCAGAGGTGTCTGCATTATTGGGCCGAATCCCTTCTGCTGTGGGCTATCAGCCTACCCTGGCCACTGACATGGGTACTATGCAGGAAAGAATTACCACTACCAAGAAGGGATCTATCACCTCTGTACAGGCTATCTATGTGCCTGCTGATGACTTGACTGACCCTGCCCCTGCTACTACGTTTGCCCATTTGGATGCTACCACTGTACTGTCGCGTGCCATTGCTGAGCTGGGCATCTATCCAGCTGTGGATCCTCTAGACTCCACCTCTCGTATCATGGATCCCAACATTGTTGGCAGTGAGCATTACGATGTTGCCCGTGGGGTGCAAAAGATCCTGCAGGACTACAAATCCCTCCAGGATATCATTGCCATCCTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGACCGTGTCCCGTGCACGGAAAATACAGCGTTTCTTGTCTCAGCCATTCCAGGTTGCTGAGGTCTTCACAGGTCATATGGGGAAGCTGGTACCCCTGAAGGAGACCATCAAAGGATTCCAGCAGATTTTGGCAGGTGAATATGACCATCTCCCAGAACAGGCCTTCTATATGGTGGGACCCATTGAAGAAGCTGTGGCAAAAGCTGATAAGCTGGCTGAAGAGCATTCATCGTGAGGGGTCTTTGTCCTCTGTACTGTCTCTCTCCTTGCCCCTAACCCAAAAAGCTTCATTTTTCTGTGTAGGCTGCACAAGAGCCTTGATTGAAGATATATTCTTTCTGAACAGTATTTAAGGTTTCCAATAAAATGTACACCCCTCA