Transcript asmbl_33481

Sequence
Transcript Sequence for observation asmbl_33481 of TGE0057007:
CCGGGCTGGGCGCCGCCGCCGGTTCGTCTACTCTTTCCTTCAGCCGCCTCCTTTCAACCTTGTCAACCCGTCGGCGCGGCCTCTGGTGCAGCGGCGGCGGCTCCTGTTCCTGCCGCAGCTCTCTCCCTTTCTTACCTCCCCACCAGATCCCGGAGATCGCCCGCCATGGCTTTACTTACTGCGGCCGCCCGGCTCTTGGGAACCAAGGCACCCAGTGGCAAGTACTAGCTGAGCATTTGGGAGATGCTTGTCTTACTTGGCTGTTGCTTCTCCTGCTGCTGGGGAAAAGGAATGCATCTTGTCTTGTTCTTGCAGCCCGGCATGCCAGTGCTTCCTCCACGAATTTGAAAGACATATTGGCTGACCTGATACCTAAGGAGCAGGCCAGAATTAAGACTTTCAGGCAGCAACATGGCAAGACGGTGGTGGGCCAAATCACTGTGGACATGATGTATGGTGGCATGAGAGGCATGAAGGGATTGGTCTATGAAACATCAGTTCTTGATCCTGATGAGGGCATCCGTTTCCGAGGCTTTAGTATCCCTGAATGCCAGAAACTGCTACCCAAGGCTAAGGGTGGGGAAGAACCCCTGCCTGAGGGCTTATTTTGGCTGCTGGTAACTGGACATATCCCAACAGAGGAACAGGTATCTTGGCTCTCAAAAGAGTGGGCAAAGAGGGCAGCTCTGCCTTCCCATGTGGTCACCATGCTGGACAACTTTCCCACCAATCTACACCCCATGTCTCAGCTCAGTGCAGCTGTTACAGCCCTCAACAGTGAAAGTAACTTTGCCCGAGCATATGCACAGGGTATCAGCCGAACCAAGTACTGGGAGTTGATTTATGAAGACTCTATGGATCTAATCGCAAAGCTACCTTGTGTTGCAGCAAAGATCTACCGAAATCTCTACAGAGAAGGCAGCGGTATTGGGGCCATTGACTCTAACCTGGACTGGTCTCACAATTTCACCAACATGTTAGGCTATACTGATCATCAGTTCACTGAGCTCACGCGCCTGTACCTCACCATCCACAGTGACCATGAGGGTGGCAATGTAAGTGCCCATACCAGCCATTTGGTGGGCAGTGCCCTTTCCGACCCTTACCTGTCCTTTGCAGCAGCCATGAACGGGCTGGCAGGGCCTCTCCATGGACTGGCAAATCAGGAAGTGCTTGTCTGGCTAACACAGCTGCAGAAGGAAGTTGGCAAAGATGTGTCAGATGAGAAGTTACGAGACTACATCTGGAACACACTCAACTCAGGACGGGTTGTTCCAGGCTATGGCCATGCAGTACTAAGGAAGACTGATCCGCGATATACCTGTCAGCGAGAGTTTGCTCTGAAACACCTGCCTAATGACCCCATGTTTAAGTTGGTTGCTCAGCTGTACAAGATTGTGCCCAATGTCCTCTTAGAGCAGGGTAAAGCCAAGAATCCTTGGCCCAATGTAGATGCTCACAGTGGGGTGCTGCTCCAGTATTATGGCATGACGGAGATGAATTACTACACGGTCCTGTTTGGGGTGTCACGAGCATTGGGTGTACTGGCACAGCTCATCTGGAGCCGAGCCTTAGGCTTCCCTCTAGAAAGGCCCAAGTCCATGAGCACAGAGGGTCTGATGAAGTTTGTGGACTCTAAGTCAGGGTAAAACTGGAGACTGGGTGAAAGTGACTACCAGAAAGTGAGGAAGCCTAAATAAAAAGTATACTTTTGTTTCAGGGGGCCTTTAAAGACTTAAGATTAAATTATATCTGAGGCACTGATAATATGTTTGAGGTTAAAATATAAATTAAGACTTTAAAAGATGAAAAATGGTCCCTTCTTCCCTAATCAGCTCCCTTCCCCTGCCTGGTATGAGTTGCCCATCATACGCATGGTCCTGGAGGATGACCAGGACTAATGCATGTGGTATGAGTAGGTTTGGCCCCCTCACTATCTCTAGAGTGAGAATCTGGCTCCTGTTTCCATGGGTCAAAGCCGGTTGCAGAGAATCTGTAGTCACTTTGGAGCTTTAGCTTCTCTGCCAAGCCCTCAATAAGCCAGCAAACCAGGACTCTGCCCCTTCTGTTTCCATAGGAATCATGTTGGATAGTCAGCTGTACCAAGCCCCTTGGCCCTCTCCCATGCACACAAACACCTCCTAGCAAGACCTGTTGGTTAGCTGGACATGCTTTGGCAATTTTTTTATACTACCAAGTGACCATAAAGGCATGGCATTTGTTGTGACTGGCACCCAATGTTTGATTTTTTTTTTAAAACTATCCAATTAAAATTAAGGTCTGGGAGTGTTCTGTTTCCCATTACTTTAATACTCACCTCCTCCCAGACTTTCTACACCTGTTGCACCTCAGGCAGAGGATGTTCTGGACCTCCCCCTCTTGGTCCCTACTAGAGACCTCTCAACAGATCTGTGGGCCCAGTCATTGGGTTTTATCAGTGCTTAATGTGAACTAAGTTTTTTACTTCCACAGAATACAAGCCACTACCTTCTGACCTCCCCACCCCCCACCAACCCCCATCTTTTAATATGCTGTGGGGCATAGAACTCCGGAATGACCAGCATGATATTTTCAGAGTCTTGTCCCCGGGGTATTAGCACCTCTTTTTGAACAGGGAATTGATTCAAGATTGGACATGGTCTCCTCTGATTATCAGGTACTGGGGCTGAGGGCATTAAAAATAGTAAGCCTCCCTCCTCGTCCCCTGCCTCAAGAAATTGCCTCCTTATTTATCAACATCTTTTTCCTCCCTTTCCCTGAGAGCTCACAGTACAATGTTTCAGAAGCCCCATTTGCACAGGTTTTCAGCAACTCAGAATGCTCTACTTCTTTTTCTTTGAGAAAGGATTAAGATACACTCCTGCTGTGCCCCCATCTTTCCTCCAAACTCCTGCCTGTGTTTGTGTGGATACCCAGTCCCAGAACCACACTGTTGAGTTGGACACACTGTAAACCCCTGGGTAACTGTCAAGTCATGATGGAGACTTCAGGTTGTTCTGTATAAAATGCAAAATAAATGTTTTTATTAACAATG