Transcript asmbl_33480

Sequence
Transcript Sequence for observation asmbl_33480 of TGE0056507:
GTAAGGTTTGGAAAAGAAGACTAAGAATAAGAATCATTGCGGCCAGCCTGACCTTGGGGCAGAGGATTTGGCAACCACCTGGCCTCTTATTATCCTGAGTATTTCCTGGAAGTGTTTGTTACTATTGTTATTGTTATAGCTGCTATTATTATTATATTACTATTTAACAAATAATTTACTCAGTGGTATAGTGAGATGGGAATATCAATACATTTGCCTAATTCTTTTAAATGTTTTAAGTAGTGTAAAATATACATAACATAAAATTTACCATTTTAATCATTTTTAAGTATATGGTTTAGTGGCAGTAGATATGTTTACATTATTGTGCAACCATCCATCTCCAGAACTTTTGTCTGCCCAAACCGAGAAACTGTTCCCATTAAACATTAACTCCTCATTCCTTCTTCCCCCTGCCTAATTCTTTTACCCTCATTTGTGCAGAGTAGTTGACCAGACTTCCCTGGCAGATAAAGCCAGCTTCTAAAAAGCAAATTCTTGACACACCTACTTTGCAGGAAATCTAATAAACTTTTAGACCATTGCTTAGTCCTTCTACTTTTCTTTTTAGAATTTGAAAGACATATTGGCTGACCTGATACCTAAGGAGCAGGCCAGAATTAAGACTTTCAGGCAGCAACATGGCAAGACGGTGGTGGGCCAAATCACTGTGGACATGATGTATGGTGGCATGAGAGGCATGAAGGGATTGGTCTATGAAACATCAGTTCTTGATCCTGATGAGGGCATCCGTTTCCGAGGCTTTAGTATCCCTGAATGCCAGAAACTGCTACCCAAGGCTAAGGGTGGGGAAGAACCCCTGCCTGAGGGCTTATTTTGGCTGCTGGTAACTGGACATATCCCAACAGAGGAACAGGTATCTTGGCTCTCAAAAGAGTGGGCAAAGAGGGCAGCTCTGCCTTCCCATGTGGTCACCATGCTGGACAACTTTCCCACCAATCTACACCCCATGTCTCAGCTCAGTGCAGCTGTTACAGCCCTCAACAGTGAAAGTAACTTTGCCCGAGCATATGCACAGGGTATCAGCCGAACCAAGTACTGGGAGTTGATTTATGAAGACTCTATGGATCTAATCGCAAAGCTACCTTGTGTTGCAGCAAAGATCTACCGAAATCTCTACAGAGAAGGCAGCGGTATTGGGGCCATTGACTCTAACCTGGACTGGTCTCACAATTTCACCAACATGTTAGGCTATACTGATCATCAGTTCACTGAGCTCACGCGCCTGTACCTCACCATCCACAGTGACCATGAGGGTGGCAATGTAAGTGCCCATACCAGCCATTTGGTGGGCAGTGCCCTTTCCGACCCTTACCTGTCCTTTGCAGCAGCCATGAACGGGCTGGCAGGGCCTCTCCATGGACTGGCAAATCAGGAAGTGCTTGTCTGGCTAACACAGCTGCAGAAGGAAGTTGGCAAAGATGTGTCAGATGAGAAGTTACGAGACTACATCTGGAACACACTCAACTCAGGACGGGTTGTTCCAGGCTATGGCCATGCAGTACTAAGGAAGACTGATCCGCGATATACCTGTCAGCGAGAGTTTGCTCTGAAACACCTGCCTAATGACCCCATGTTTAAGTTGGTTGCTCAGCTGTACAAGATTGTGCCCAATGTCCTCTTAGAGCAGGGTAAAGCCAAGAATCCTTGGCCCAATGTAGATGCTCACAGTGGGGTGCTGCTCCAGTATTATGGCATGACGGAGATGAATTACTACACGGTCCTGTTTGGGGTGTCACGAGCATTGGGTGTACTGGCACAGCTCATCTGGAGCCGAGCCTTAGGCTTCCCTCTAGAAAGGCCCAAGTCCATGAGCACAGAGGGTCTGATGAAGTTTGTGGACTCTAAGTCAGGGTAAAACTGGAGACTGGGTGAAAGTGACTACCAGAAAGTGAGGAAGCCTAAATAAAAAGTATACTTTTGTTTCAGGGGGCCTTTAAAGACTTAAGATTAAATTATATCTGAGGCACTGATAATATGTTTGAGGTTAAAATATAAATTAAGACTTTAAAAGATGAAAAATGGTCCCTTCTTCCCTAATCAGCTCCCTTCCCCTGCCTGGTATGAGTTGCCCATCATACGCATGGTCCTGGAGGATGACCAGGACTAATGCATGTGGTATGAGTAGGTTTGGCCCCCTCACTATCTCTAGAGTGAGAATCTGGCTCCTGTTTCCATGGGTCAAAGCCGGTTGCAGAGAATCTGTAGTCACTTTGGAGCTTTAGCTTCTCTGCCAAGCCCTCAATAAGCCAGCAAACCAGGACTCTGCCCCTTCTGTTTCCATAGGAATCATGTTGGATAGTCAGCTGTACCAAGCCCCTTGGCCCTCTCCCATGCACACAAACACCTCCTAGCAAGACCTGTTGGTTAGCTGGACATGCTTTGGCAATTTTTTTATACTACCAAGTGACCATAAAGGCATGGCATTTGTTGTGACTGGCACCCAATGTTTGATTTTTTTTTTAAAACTATCCAATTAAAATTAAGGTCTGGGAGTGTTCTGTTTCCCATTACTTTAATACTCACCTCCTCCCAGACTTTCTACACCTGTTGCACCTCAGGCAGAGGATGTTCTGGACCTCCCCCTCTTGGTCCCTACTAGAGACCTCTCAACAGATCTGTGGGCCCAGTCATTGGGTTTTATCAGTGCTTAATGTGAACTAAGTTTTTTACTTCCACAGAATACAAGCCACTACCTTCTGACCTCCCCACCCCCCACCAACCCCCATCTTTTAATATGCTGTGGGGCATAGAACTCCGGAATGACCAGCATGATATTTTCAGAGTCTTGTCCCCGGGGTATTAGCACCTCTTTTTGAACAGGGAATTGATTCAAGATTGGACATGGTCTCCTCTGATTATCAGGTACTGGGGCTGAGGGCATTAAAAATAGTAAGCCTCCCTCCTCGTCCCCTGCCTCAAGAAATTGCCTCCTTATTTATCAACATCTTTTTCCTCCCTTTCCCTGAGAGCTCACAGTACAATGTTTCAGAAGCCCCATTTGCACAGGTTTTCAGCAACTCAGAATGCTCTACTTCTTTTTCTTTGAGAAAGGATTAAGATACACTCCTGCTGTGCCCCCATCTTTCCTCCAAACTCCTGCCTGTGTTTGTGTGGATACCCAGTCCCAGAACCACACTGTTGAGTTGGACACACTGTAAACCCCTGGGTAACTGTCAAGTCATGATGGAGACTTCAGGTTGTTCTGTATAAAATGCAAAATAAATGTTTTTATTAACAATG