Transcript asmbl_33479

Sequence
Transcript Sequence for observation asmbl_33479 of TGE0057006:
CCGGGCTGGGCGCCGCCGCCGGTTCGTCTACTCTTTCCTTCAGCCGCCTCCTTTCAACCTTGTCAACCCGTCGGCGCGGCCTCTGGTGCAGCGGCGGCGGCTCCTGTTCCTGCCGCAGCTCTCTCCCTTTCTTACCTCCCCACCAGATCCCGGAGATCGCCCGCCATGGCTTTACTTACTGCGGCCGCCCGGCTCTTGGGAACCAAGAATGCATCTTGTCTTGTTCTTGCAGCCCGGCATGCCAGTGCTTCCTCCACGAATTTGAAAGACATATTGGCTGACCTGATACCTAAGGAGCAGGCCAGAATTAAGACTTTCAGGCAGCAACATGGCAAGACGGTGGTGGGCCAAATCACTGTGGACATGATGTATGGTGGCATGAGAGGCATGAAGGGATTGGTCTATGAAACATCAGTTCTTGATCCTGATGAGGGCATCCGTTTCCGAGGCTTTAGTATCCCTGAATGCCAGAAACTGCTACCCAAGGCTAAGGGTGGGGAAGAACCCCTGCCTGAGGGCTTATTTTGGCTGCTGGTAACTGGACATATCCCAACAGAGGAACAGGTATCTTGGCTCTCAAAAGAGTGGGCAAAGAGGGCAGCTCTGCCTTCCCATGTGGTCACCATGCTGGACAACTTTCCCACCAATCTACACCCCATGTCTCAGCTCAGTGCAGCTGTTACAGCCCTCAACAGTGAAAGTAACTTTGCCCGAGCATATGCACAGGGTATCAGCCGAACCAAGTACTGGGAGTTGATTTATGAAGACTCTATGGATCTAATCGCAAAGCTACCTTGTGTTGCAGCAAAGATCTACCGAAATCTCTACAGAGAAGGCAGCGGTATTGGGGCCATTGACTCTAACCTGGACTGGTCTCACAATTTCACCAACATGTTAGGCTATACTGATCATCAGTTCACTGAGCTCACGCGCCTGTACCTCACCATCCACAGTGACCATGAGGGTGGCAATGTAAGTGCCCATACCAGCCATTTGGTGGGCAGTGCCCTTTCCGACCCTTACCTGTCCTTTGCAGCAGCCATGAACGGGCTGGCAGGGCCTCTCCATGGACTGGCAAATCAGGAAGTGCTTGTCTGGCTAACACAGCTGCAGAAGGAAGTTGGCAAAGATGTGTCAGATGAGAAGTTACGAGACTACATCTGGAACACACTCAACTCAGGACGGGTTGTTCCAGGCTATGGCCATGCAGTACTAAGGAAGACTGATCCGCGATATACCTGTCAGCGAGAGTTTGCTCTGAAACACCTGCCTAATGACCCCATGTTTAAGTTGGTTGCTCAGCTGTACAAGATTGTGCCCAATGTCCTCTTAGAGCAGGGTAAAGCCAAGAATCCTTGGCCCAATGTAGATGCTCACAGTGGGGTGCTGCTCCAGTATTATGGCATGACGGAGATGAATTACTACACGGTCCTGTTTGGGGTGTCACGAGCATTGGGTGTACTGGCACAGCTCATCTGGAGCCGAGCCTTAGGCTTCCCTCTAGAAAGGCCCAAGTCCATGAGCACAGAGGGTCTGATGAAGTTTGTGGACTCTAAGTCAGGGTAAAACTGGAGACTGGGTGAAAGTGACTACCAGAAAGTGAGGAAGCCTAAATAAAAAGTATACTTTTGTTTCAGGGGGCCTTTAAAGACTTAAGATTAAATTATATCTGAGGCACTGATAATATGTTTGAGGTTAAAATATAAATTAAGACTTTAAAAGATGAAAAATGGTCCCTTCTTCCCTAATCAGCTCCCTTCCCCTGCCTGGTATGAGTTGCCCATCATACGCATGGTCCTGGAGGATGACCAGGACTAATGCATGTGGTATGAGTAGGTTTGGCCCCCTCACTATCTCTAGAGTGAGAATCTGGCTCCTGTTTCCATGGGTCAAAGCCGGTTGCAGAGAATCTGTAGTCACTTTGGAGCTTTAGCTTCTCTGCCAAGCCCTCAATAAGCCAGCAAACCAGGACTCTGCCCCTTCTGTTTCCATAGGAATCATGTTGGATAGTCAGCTGTACCAAGCCCCTTGGCCCTCTCCCATGCACACAAACACCTCCTAGCAAGACCTGTTGGTTAGCTGGACATGCTTTGGCAATTTTTTTATACTACCAAGTGACCATAAAGGCATGGCATTTGTTGTGACTGGCACCCAATGTTTGATTTTTTTTTTAAAACTATCCAATTAAAATTAAGGTCTGGGAGTGTTCTGTTTCCCATTACTTTAATACTCACCTCCTCCCAGACTTTCTACACCTGTTGCACCTCAGGCAGAGGATGTTCTGGACCTCCCCCTCTTGGTCCCTACTAGAGACCTCTCAACAGATCTGTGGGCCCAGTCATTGGGTTTTATCAGTGCTTAATGTGAACTAAGTTTTTTACTTCCACAGAATACAAGCCACTACCTTCTGACCTCCCCACCCCCCACCAACCCCCATCTTTTAATATGCTGTGGGGCATAGAACTCCGGAATGACCAGCATGATATTTTCAGAGTCTTGTCCCCGGGGTATTAGCACCTCTTTTTGAACAGGGAATTGATTCAAGATTGGACATGGTCTCCTCTGATTATCAGGTACTGGGGCTGAGGGCATTAAAAATAGTAAGCCTCCCTCCTCGTCCCCTGCCTCAAGAAATTGCCTCCTTATTTATCAACATCTTTTTCCTCCCTTTCCCTGAGAGCTCACAGTACAATGTTTCAGAAGCCCCATTTGCACAGGTTTTCAGCAACTCAGAATGCTCTACTTCTTTTTCTTTGAGAAAGGATTAAGATACACTCCTGCTGTGCCCCCATCTTTCCTCCAAACTCCTGCCTGTGTTTGTGTGGATACCCAGTCCCAGAACCACACTGTTGAGTTGGACACACTGTAAACCCCTGGGTAACTGTCAAGTCATGATGGAGACTTCAGGTTGTTCTGTATAAAATGCAAAATAAATGTTTTTATTAACAATG