Transcript asmbl_33308

Sequence
Transcript Sequence for observation asmbl_33308 of TGE0000139:
CAGCCTAGGGTTAGCGTGGGAAGACCCTCCGCGGTCTTTGGCGTTTTGGAAAGATACCCACACATTCCCGGGAAAACATGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATTGGCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACGGGCGCTGGCAAGCACGTGCCCCGGGCTGTGTTTGTAGACTTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTATGCCCGAGGGCACTACACCATTGGCAAGGAGATCATTGACCTTGTGTTGGACCGAATTCGCAAGCTGGCTGACCAGTGCACCGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGTGGGGGAACTGGTTCTGGGTTCACCTCCCTGCTCATGGAACGTCTCTCAGTTGATTATGGCAAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCACCCCAGGTTTCCACAGCTGTAGTTGAGCCCTACAACTCCATCCTCACCACCCACACCACCCTGGAGCACTCTGATTGTGCCTTCATGGTAGACAATGAGGCCATCTATGACATCTGTCGTAGAAACCTCGATATCGAGCGCCCAACCTACACTAACCTTAACCGCCTTATTAGCCAGATTGTGTCCTCCATCACTGCTTCCCTGAGATTTGATGGAGCCCTGAATGTTGACCTGACAGAATTCCAGACCAACCTGGTGCCCTACCCCCGCATCCACTTCCCTCTGGCCACATATGCCCCTGTCATCTCTGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCAGAGATCACCAATGCTTGCTTTGAGCCAGCCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCTTGCTGCCTGTTGTACCGTGGTGACGTGGTTCCCAAAGATGTCAATGCTGCCATTGCCACCATCAAAACCAAGCGCAGCATCCAGTTTGTGGATTGGTGCCCCACTGGCTTCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTGCCTGGTGGAGACCTGGCCAAGGTACAGAGAGCTGTGTGCATGCTGAGCAACACCACAGCCATTGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGACCTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGGATGGAGGAAGGCGAGTTTTCAGAGGCCCGTGAAGATATGGCTGCCCTTGAGAAGGATTATGAGGAGGTTGGTGTGGATTCTGTTGAAGGAGAGGGTGAGGAAGAAGGAGAGGAATACTAATTATCCATTCCTTTTGGCCCTGCAGCATGTCATGCTCCCAGAATTTCAGCTTCAGCTTAACTGACAGACGTTAAAGCTTTCTGGTTAGATTGTTTTCACTTGGTGATCATGTCTTTTCCATGTGTACCTGTAATATTTTTCCATCATATCTCAAAGTAAAGTCATTAACATCAAAA