Transcript asmbl_33001

Sequence
Transcript Sequence for observation asmbl_33001 of TGE0056179:
GTGAGAAGCACCATAAAAGGCGTTGTGAGGAGTTGTGGGGGAGTGAGGGAGAGAAGAGGTTGAAAAGCTTATTAGCTGCTGTACGGTAAAAGTGAGCTCTTACGGGAATGGGAATGTAGTTTTAGCCCTCCAGGGATTCTATTTAGCCCGCCAGGAATTAACCTTGACTATAAATAGGCCATCAATGACCTTTCCAGAGAATGTTCAGAGACCTCAACTTTGTTTAGAGATCTTGTGTGGGTGGAACTTCCTGTTTGCACACAGAGCAGCATAAAGCCCAGTTGCTTTGGGAAGTGTTTGGGACCAGATGGATTGTAGGGAGTAGGGTACAATACAGTCTGTTCTCCTCCAGCTCCTTCTTTCTGCAACATGGGGAAGAACAAACTCCTTCATCCAAGTCTGGTTCTTCTCCTCTTGGTCCTCCTGCCCACAGACGCCTCAGTCTCTGGAAAACCGCAGTATATGGTTCTGGTCCCCTCCCTGCTCCACACTGAGACCACTGAGAAGGGCTGTGTCCTTCTGAGCTACCTGAATGAGACAGTGACTGTAAGTGCTTCCTTGGAGTCTGTCAGGGGAAACAGGAGCCTCTTCACTGACCTGGAGGCGGAGAATGACGTACTCCACTGTGTCGCCTTCGCTGTCCCAAAGTCTTCATCCAATGAGGAGGTAATGTTCCTCACTGTCCAAGTGAAAGGACCAACCCAAGAATTTAAGAAGCGGACCACAGTGATGGTTAAGAACGAGGACAGTCTGGTCTTTGTCCAGACAGACAAATCAATCTACAAACCAGGGCAGACAGTGAAATTTCGTGTTGTCTCCATGGATGAAAACTTTCACCCCCTGAATGAGTTGATTCCACTAGTATACATTCAGGATCCCAAAGGAAATCGCATCGCACAATGGCAGAGTTTCCAGTTAGAGGGTGGCCTCAAGCAATTTTCTTTTCCCCTCTCATCAGAGCCCTTCCAGGGCTCCTACAAGGTGGTGGTACAGAAGAAATCAGGTGGAAGGACAGAGCACCCTTTCACCGTGGAGGAATTTGTTCTTCCCAAGTTTGAAGTACAAGTAACAGTGCCAAAGATAATCACCATCTTGGAAGAAGAGATGAATGTATCAGTGTGTGGCCTATACACATATGGGAAGCCTGTCCCTGGACATGTGACTGTGAGCATTTGCAGAAAGTATAGTGACGCTTCCGACTGCCACGGTGAAGATTCACAGGCTTTCTGTGAGAAATTCAGTGGACAGCTAAACAGCCATGGCTGCTTCTATCAGCAAGTAAAAACCAAGGTCTTCCAGCTGAAGAGGAAGGAGTATGAAATGAAACTTCACACTGAGGCCCAGATCCAAGAAGAAGGAACAGTGGTGGAATTGACTGGAAGGCAGTCCAGTGAAATCACAAGAACCATAACCAAACTCTCATTTGTGAAAGTGGACTCACACTTTCGACAGGGAATTCCCTTCTTTGGGCAGGTGCGCCTAGTAGATGGGAAAGGCGTCCCTATACCAAATAAAGTCATATTCATCAGAGGAAATGAAGCAAACTATTACTCCAATGCTACCACGGATGAGCATGGCCTTGTACAGTTCTCTATCAACACCACCAATGTTATGGGTACCTCTCTTACTGTTAGGGTCAATTACAAGGATCGTAGTCCCTGTTACGGCTACCAGTGGGTGTCAGAAGAACACGAAGAGGCACATCACACTGCTTATCTTGTGTTCTCCCCAAGCAAGAGCTTTGTCCACCTTGAGCCCATGTCTCATGAACTACCCTGTGGCCATACTCAGACAGTCCAGGCACATTATATTCTGAATGGAGGCACCCTGCTGGGGCTGAAGAAGCTCTCCTTCTATTATCTGATAATGGCAAAGGGAGGCATTGTCCGAACTGGGACTCATGGACTGCTTGTGAAGCAGGAAGACATGAAGGGCCATTTTTCCATCTCAATCCCTGTGAAGTCAGACATTGCTCCTGTCGCTCGGTTGCTCATCTATGCTGTTTTACCTACCGGGGACGTGATTGGGGATTCTGCAAAATATGATGTTGAAAATTGTCTGGCCAACAAGGTGGATTTGAGCTTCAGCCCATCACAAAGTCTCCCAGCCTCACACGCCCACCTGCGAGTCACAGCGGCTCCTCAGTCCGTCTGCGCCCTCCGTGCTGTGGACCAAAGCGTGCTGCTCATGAAGCCTGATGCTGAGCTCTCGGCGTCCTCGGTTTACAACCTGCTACCAGAAAAGGACCTCACTGGCTTCCCTGGGCCTTTGAATGACCAGGACAATGAAGACTGCATCAATCGTCATAATGTCTATATTAATGGAATCACATATACTCCAGTATCAAGTACAAATGAAAAGGATATGTACAGCTTCCTAGAGGACATGGGCTTAAAGGCATTCACCAACTCAAAGATTCGTAAACCCAAAATGTGTCCACAGCTTCAACAGTATGAAATGCATGGACCTGAAGGTCTACGTGTAGGTTTTTATGAGTCAGATGTAATGGGAAGAGGCCATGCACGCCTGGTGCATGTTGAAGAGCCTCACACGGAGACCGTACGAAAGTACTTCCCTGAGACATGGATCTGGGATTTGGTGGTGGTAAACTCAGCAGGTGTGGCTGAGGTAGGAGTAACAGTCCCTGACACCATCACCGAGTGGAAGGCAGGGGCCTTCTGCCTGTCTGAAGATGCTGGACTTGGTATCTCTTCCACTGCCTCTCTCCGAGCCTTCCAGCCCTTCTTTGTGGAGCTCACAATGCCTTACTCTGTGATTCGTGGAGAGGCCTTCACACTCAAGGCCACGGTCCTAAACTACCTTCCCAAATGCATCCGGGTCAGTGTGCAGCTGGAAGCCTCTCCCGCCTTCCTAGCTGTCCCAGTGGAGAAGGAACAAGCGCCTCACTGCATCTGTGCAAACGGGCGGCAAACTGTGTCCTGGGCAGTAACCCCAAAGTCATTAGGAAATGTGAATTTCACTGTGAGCGCAGAGGCACTAGAGTCTCAAGAGCTGTGTGGGACTGAGGTGCCTTCAGTTCCTGAACACGGAAGGAAAGACACAGTCATCAAGCCTCTGTTGGTTGAACCTGAAGGACTAGAGAAGGAAACAACATTCAACTCCCTACTTTGTCCATCAGGTGGTGAGGTTTCTGAAGAATTATCCCTGAAACTGCCACCAAATGTGGTAGAAGAATCTGCCCGAGCTTCTGTCTCAGTTTTGGGAGACATATTAGGCTCTGCCATGCAAAACACACAAAATCTTCTCCAGATGCCCTATGGCTGTGGAGAGCAGAATATGGTCCTCTTTGCTCCTAACATCTATGTACTGGATTATCTAAATGAAACACAGCAGCTTACTCCAGAGATCAAGTCCAAGGCCATTGGCTATCTCAACACTGGTTACCAGAGACAGTTGAACTACAAACACTATGATGGCTCCTACAGCACCTTTGGGGAGCGATATGGCAGGAACCAGGGCAACACCTGGCTCACAGCCTTTGTTCTGAAGACTTTTGCCCAAGCTCGAGCCTACATCTTCATCGATGAAGCACACATTACCCAAGCCCTCATATGGCTCTCCCAGAGGCAGAAGGACAATGGCTGTTTCAGGAGCTCTGGGTCACTGCTCAACAATGCCATAAAGGGAGGAGTAGAAGATGAAGTGACCCTCTCCGCCTATATCACCATCGCCCTTCTGGAGATTCCTCTCACAGTCACTCACCCTGTTGTCCGCAATGCCCTGTTTTGCCTGGAGTCAGCCTGGAAGACAGCACAAGAAGGGGACCATGGCAGCCATGTATATACCAAAGCACTGCTGGCCTATGCTTTTGCCCTGGCAGGTAACCAGGACAAGAGGAAGGAAGTACTCAAGTCACTTAATGAGGAAGCTGTGAAGAAAGACAACTCTGTCCATTGGGAGCGCCCTCAGAAACCCAAGGCACCAGTGGGGCATTTTTACGAACCCCAGGCTCCCTCTGCTGAGGTGGAGATGACATCCTATGTGCTCCTCGCTTATCTCACGGCCCAGCCAGCCCCAACCTCGGAGGACCTGACCTCTGCAACCAACATCGTGAAGTGGATCACGAAGCAGCAGAATGCCCAGGGCGGTTTCTCCTCCACCCAGGACACAGTGGTGGCTCTCCATGCTCTGTCCAAATATGGAGCAGCCACATTTACCAGGACTGGGAAGGCTGCACAGGTGACTATCCAGTCTTCAGGGACATTTTCCAGCAAATTCCAAGTGGACAACAACAACCGCCTGTTACTGCAGCAGGTCTCATTGCCAGAGCTGCCTGGGGAATACAGCATGAAAGTGACAGGAGAAGGATGTGTCTACCTCCAGACATCCTTGAAATACAATATTCTCCCAGAAAAGGAAGAGTTCCCCTTTGCTTTAGGAGTGCAGACTCTGCCTCAAACTTGTGATGAACCCAAAGCCCACACCAGCTTCCAAATCTCCCTAAGTGTCAGTTACACAGGGAGCCGCTCTGCCTCCAACATGGCGATCGTTGATGTGAAGATGGTCTCTGGCTTCATTCCCCTGAAGCCAACAGTGAAAATGCTTGAAAGATCTAACCATGTGAGCCGGACAGAAGTCAGCAGCAACCATGTCTTGATTTACCTTGATAAGGTGTCAAATCAGACACTGAGCTTGTTCTTCACGGTTCTGCAAGATGTCCCAGTAAGAGATCTGAAACCAGCCATAGTGAAAGTCTATGATTACTACGAGACGGATGAGTTTGCAATTGCTGAGTACAATGCTCCTTGCAGCAAAGATCTTGGAAATGCTTGAAGACCACAAGGCTGAAAAGTGCTTTGCTGGAGTCCTGTTCTCAGAGCTCCACAGAAGACACGTGTTTTTGTATCTTTAAAGACTTGATGAATAAACACTTTTTCTGGTCAATGTCTTTCCCTGTTTCCTGTTCATTCAATAAATATCATTGTACATTTCCATATGATTCCCAAT