Transcript asmbl_27288

Sequence
Transcript Sequence for observation asmbl_27288 of TGE0057003:
AACATCCACATCGCCCTTCACTTTGGGTCCTTTCAGGTTTAAGTCAATATCAGGCATGGAGATCTTGGGGGCTTTGATGTTCATCTCTGGCATCTTTAACTTAGGCCCTTTCAACTTTCCCTCTGGTCCTTCAATATTAACATCAGGGCCTTCAATGTCCACCTTGGGTCCTGAGATGTCAACGTCAGCCTTAGGCAAGTTGACGTCTACTTCAGGGCCCTCTGCTTTGAAGCCAGGCATGCTGAACTT