Transcript asmbl_26854

Sequence
Transcript Sequence for observation asmbl_26854 of TGE0056489:
AGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCAGGCCTCCGGCGCCCAGCGCCCCACGCGCCCCCGCGCCCCCGCGCCCCCGCGCCCCTTTCTTCGCGCCCCCGCCCCTCGGCCCGCCAGGCCCCCTTGCCGGCCACCCGCCAGGCCCCGCGCCGGCCCGCCCGCCGCCCAGGACCGGCCCGCGCCCCGCAGGCCGCCCGCCGCCCGCGCCGCCATGGGAGTGGAGGGCTGCACCAAGTGCATCAAGTACCTGCTCTTCGTCTTCAATTTCGTCTTCTGGCTGGCTGGAGGCGTGATCCTGGGTGTGGCCCTGTGGCTCCGCCATGACCCGCAGACCACCAACCTCCTGTATCTGGAGCTGGGAGACAAGCCCGCGCCCAACACCTTCTATGTAGGCATCTACATCCTCATCGCTGTGGGCGCTGTCATGATGTTCGTTGGCTTCCTGGGCTGCTACGGGGCCATCCAGGAATCCCAGTGCCTGCTGGGGACGTTCTTCACCTGCCTGGTCATCCTGTTTGCCTGTGAGGTGGCCGCCGGCATCTGGGGCTTTGTCAACAAGGACCAGATCGCCAAGGATGTGAAGCAGTTCTATGACCAGGCCCTACAGCAGGCCGTGGTGGATGATGACGCCAACAACGCCAAGGCTGTGGTGAAGACCTTCCACGAGACGCTTGACTGCTGTGGCTCCAGCACACTGACTGCTTTGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGGCAGCAACATCATCAGCAACCTCTTCAAGGAGGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGTACCTCATCGGCATTGCTGCCATCGTGGTCGCTGTGATCATGATCTTCGAGATGATCCTGAGCATGGTGCTGTGCTGTGGCATCCGGAACAGCTCCGTGTACTGAGGCCCCGCAGCTCTGGCCACAGGGACCTCTGCAGTGCCCCCTAAGTGACCCGGACACTTCCGAGGGGGCCATCACCGCCTGTGTATATAACGTTTCCGGTATTACTCTGCTACACGTAGCCTTTTTACTTTTGGGGTTTTGTTTTTGTTCTGAACTTTCCTGTTACCTTTTCAGGGCTGACGTCACATGTAGGTGGCGTGTATGAGTGGAGACGGGCCTGGGTCTTGGGGACTGGAGGGCAGGGGTCCTTCTGCCCTGGGGTCCCAGGGTGCTCTGCCTGCTCAGCCAGGCCTCTCCTGGGAGCCACTCGCCCAGAGACTCAGCTTGGCCAACTTGGGGGGCTGTGTCCACCCAGCCCGCCCGTCCTGTGGGCTGCACAGCTCACCTTGTTCCCTCCTGCCCCGGTTCGAGAGCCGAGTCTGTGGGCACTCTCTGCCTTCATGCACCTGTCCTTTCTAACACGTCGCCTTCAACTGTAATCACAACATCCTGACTCCGTCATTTAATAAAGAAGGAACATCAGGCATGCTACCAGGCCTGTGCAGTCCCTCAGTGCCAGTGGTGTCTGAGACCTAGGGGTTGGCCGGAGGGCAGGGGAATCTGACATCGGTGGGGCTTGGCTCTGTGGACTCTGTGGGGTCCAGGGTGA