Transcript asmbl_26006

Sequence
Transcript Sequence for observation asmbl_26006 of TGE0056760:
AATCCTTTAATAAAATTAGTCCATCTAAAACTCCCCAATGCCTAAGGTTCTAGTCGTGGAAGGGTTAGCTGCAGAATTCCAGTTCAGAAGCCAACGGAGGCTCAGTCCAGACAGGGATTAACCGACTTGTGCTGGTATCTAGGTGCTTGGATTGCCGAGTTGAGTTTGCTGGAAGGGAAATGGGGCGGCGTCGGGGGGCCCGACAGGCCTGGCTGCCAGTCGGCTTCCGCGAAAACGACTCTTGCTGTCCACATAGCCAGCCGTGAAGCCAAACTGCAGGCCTCTGCCCTCCCCTAAATGTCCTCCTAGGAGGCAGTCACTCGGGAGGAAGATGTGCCTGTTACCAAGTGCTTCGTCCCGGCCCCAGCGCAGACCTATGAATGAAGATGGAGGGAGAGCTGATGTGAAAGGCCTGGGTCCCGGCCGCAGAAGGGGCGCCAGACCGAAATCGGCGATCGCGTCTCTCCCACCAAAGCCTCCCGGCCAGCGGCCGCGTCTGAAAGTCCTGGGCTAAGCACCACGCCGGGGGGGTACCAGACACCCCGGCTGCAGCTGCCGAGGGCCTCACTCACCTTCAGGGCCGCCGGCCTCTCGGCCTGGACTGCCCACCTCGGCCCTGCGTCAGAGCGGAAGGCCAAGTCTTCCAGAAGGTGCTGCGGCCTCCCCGCAGCCCCTTAGCGACTCGGGATGGGGCGGCTGAGTCACGAACGCCGAGGCGGGCAGGTGCGGCGCCGCCGGCCTCCCCCCGGCAGGCTCGGGTCTTCCGCGCCACGGAGGTCCCCGAAGAGCGCCCAAGCCGCATCCGGAAGGCCCGAACCCTACCGGAGGGCGGACGGCGGACAGGGCAGGGCCCGAGGCCGACGCGGCAGGCGGTGCGGGACGGGAGCGGGGGCGGGCGGGGACTCGAGGCCGGGCGGCGAAGGCGGGCGAGGGGAGGGGAGGGGAAGGGAGCCGCGGCCCGCTTGCCCCGCAGTCTGAAGCGGCTCAGCTCTTTCCATGAGGGCGGTGGTGGCCCTTAAAAGGGCCTTTGTGGTGGCATGGGGAGGCCTGGCGGCCGGCCGCGGCGCGGGCCCTCTTAGTACTCCTGGGAGGCCTGGGTGGCCTTCTTGCCGCCCGAGGGCGCCTTCGGCCCCACGGTGGCGCTGGTCTTCTTGGGCAGCAGCACGGCCTGGATGTTGGGCAGGACGCCTCCCTGGGCGATCGTCACGCCGCCCAGCAGCTTGTTGAGCTCCTCGTCGTTGCGGATGGCCAGCTGCAGGTGGCGGGGGATGATTCGCGTCTTCTTGTTGTCGCGGGCCGCATTGCCCGCCAGCTCCAGGATCTCAGCGGTGAGGTACTCCAGCACTGCCGCCAGGTACACTGGCGCGCCGGCGCCAACGCGCTCGGCGTAGTGGCCCTTCCGCAGCAGCCGGTGTACACGGCCCACTGGGAACTGGAGGCCGGCGCGCGACGAGCGCGACTTGGCCTTGGCGCGGGCCTTGCCGCCAGTCTTGCCGCGGCCCGACATGCTAGCGAGGTAGACCGGTGAAGCACGACGGCTCAAACACTAGAACAGACGCCCGCCGCAG